ID: 1076816852

View in Genome Browser
Species Human (GRCh38)
Location 10:132919261-132919283
Sequence CCCAGAGGGCGGCCGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076816839_1076816852 18 Left 1076816839 10:132919220-132919242 CCCCATGGGTTGTCATTGCACGA 0: 1
1: 0
2: 1
3: 0
4: 45
Right 1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG 0: 1
1: 0
2: 2
3: 28
4: 322
1076816841_1076816852 16 Left 1076816841 10:132919222-132919244 CCATGGGTTGTCATTGCACGAAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG 0: 1
1: 0
2: 2
3: 28
4: 322
1076816842_1076816852 -6 Left 1076816842 10:132919244-132919266 CCACAACCCTTCCCACACCCAGA 0: 1
1: 0
2: 3
3: 66
4: 720
Right 1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG 0: 1
1: 0
2: 2
3: 28
4: 322
1076816840_1076816852 17 Left 1076816840 10:132919221-132919243 CCCATGGGTTGTCATTGCACGAA 0: 1
1: 0
2: 0
3: 0
4: 60
Right 1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG 0: 1
1: 0
2: 2
3: 28
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076816852 Original CRISPR CCCAGAGGGCGGCCGTGGCC AGG Intronic
900191763 1:1355129-1355151 CCCAGTAGGCGGGGGTGGCCGGG + Exonic
900369814 1:2326677-2326699 TCCAGAGGGCAGCCGGTGCCAGG - Intronic
900524219 1:3120611-3120633 CCCAGGGGGCTGCCGGGGACAGG - Intronic
900612886 1:3551821-3551843 CCCAGAGGGTGGCCTCGGGCAGG - Intronic
900619316 1:3579774-3579796 CCCACAGGCTGGCCATGGCCAGG + Intronic
900678490 1:3903242-3903264 CCCATCGGGCGGGCGAGGCCAGG - Intergenic
901054175 1:6440889-6440911 CCCAGCTCGCGGCCGCGGCCGGG + Intronic
901396368 1:8985090-8985112 CCCAGAAAGCGGCCAGGGCCAGG - Intergenic
901438286 1:9262707-9262729 CCCAGAGGACAGCCCTGGCATGG - Intronic
901511780 1:9721278-9721300 TCCAGAGGGCAGCTGTGTCCTGG + Intronic
901627425 1:10631953-10631975 CCCAGAGCCAGGCCGAGGCCTGG - Intergenic
901829274 1:11882171-11882193 ACCAGAGGCCGGCAGAGGCCAGG + Intergenic
901851656 1:12019778-12019800 TCCAAAGCGCGGCCGGGGCCAGG + Intronic
901923916 1:12553981-12554003 CCCAGTGGGCTGCCCTTGCCAGG - Intergenic
902044320 1:13513695-13513717 GCCAGAGGGCGGCCCGGGCGGGG + Exonic
902375675 1:16028998-16029020 CCCAGCGGGGGGCCTTGGGCAGG - Intronic
902380631 1:16050750-16050772 CCCAGCGGGGGGCCTTGGGCAGG - Intronic
902406686 1:16187913-16187935 ACCAGAGGGCGGCAGAGCCCAGG - Intergenic
902621381 1:17652852-17652874 CCCACAGGGGGTCTGTGGCCAGG + Intronic
902873267 1:19326671-19326693 CCCAGAGGGCCCGGGTGGCCAGG - Intronic
903181244 1:21606024-21606046 CCCAGGGAGGGGCCGGGGCCTGG + Intronic
903281598 1:22253118-22253140 CCCTGAGGTCGGGCCTGGCCGGG + Intergenic
903417502 1:23193961-23193983 CCAAGAGGTCGGTGGTGGCCAGG + Exonic
907241103 1:53081553-53081575 CCCTGAGTGTGGCCCTGGCCTGG + Intronic
907277783 1:53326710-53326732 CCCCGAGGGAGGCGGTGCCCAGG + Intronic
907373573 1:54018222-54018244 CCCACAGGGAGGGTGTGGCCCGG - Intergenic
908951691 1:69568724-69568746 CCCAGAGGCCGGCCGGGGGCGGG + Intronic
910602184 1:89043700-89043722 ACCAGAGGGAGGCTGAGGCCGGG - Intergenic
912324772 1:108747018-108747040 GCCAGAGCGCGGCCGAGGCGAGG - Intronic
914376596 1:147078296-147078318 CCCAGTGCGCGGCTCTGGCCCGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
920215994 1:204361865-204361887 CCCAGAGGGAGGCCGGGGAGGGG + Intronic
920380585 1:205532450-205532472 CCCAGAGGGCGGCCACGACAGGG + Intronic
921029844 1:211327209-211327231 TCCAGAGGGCGGCTGTGGACCGG + Intronic
921060232 1:211578901-211578923 CCCAGGCGGCGGCGGTGGCGGGG + Intergenic
923096406 1:230778597-230778619 CCCAGAGAGCTGCCCTGCCCAGG + Intronic
924437446 1:244054818-244054840 CCCAGAGAGCGAGCGTGTCCAGG + Exonic
924738361 1:246779640-246779662 CCAAGAGGCTGGCGGTGGCCTGG - Intergenic
1063450178 10:6145509-6145531 CCCGGAGGGCGGCGGGGCCCGGG + Intronic
1067578163 10:47420601-47420623 CGCAGAGGCCAGCCTTGGCCAGG - Intergenic
1070151965 10:73811028-73811050 GCCAGACGGGGGCCGGGGCCGGG + Intronic
1070311154 10:75275189-75275211 ACCAGAGGGGGTCCCTGGCCTGG + Intergenic
1071553438 10:86584916-86584938 CCCTGAGGGCTGCCGTACCCAGG + Intergenic
1071602777 10:86966986-86967008 CCCAGAGCGAGGCCTTGCCCTGG - Intronic
1072591729 10:96833071-96833093 CTCAGCGGGCGGCGGTGGCCGGG + Exonic
1074138004 10:110644378-110644400 GCCAGTGAGCGCCCGTGGCCCGG + Exonic
1074503131 10:114044025-114044047 CGCAGAGGGAGGTCGCGGCCGGG - Intergenic
1076007153 10:126956825-126956847 CTCAGAGGGAGGGAGTGGCCAGG + Intronic
1076023366 10:127092383-127092405 CACAGAGGGCGGCCAGTGCCAGG - Intronic
1076113568 10:127879902-127879924 CTCAAAGGGCTTCCGTGGCCAGG - Intronic
1076139760 10:128069685-128069707 CCCAAAGCGCGGGCGTGGGCCGG + Exonic
1076202251 10:128568007-128568029 GCCACAGGGCGGCCGTGGTAGGG + Intergenic
1076461407 10:130649898-130649920 CCCAGAGTGCAGCCCTGCCCTGG + Intergenic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG + Intronic
1077048283 11:555606-555628 ACCAGGGGGCGGCCGGGGCGGGG + Intronic
1077164411 11:1128743-1128765 TCCAGAGGGGGGCCGAGGCCTGG + Intergenic
1077322242 11:1947591-1947613 CCCAGGGGGCGGGCGTGGCCGGG + Intronic
1077329805 11:1979278-1979300 GCCCGAGGGCAGCCCTGGCCAGG - Intronic
1077441246 11:2570207-2570229 GCCAGAGGGCGTCCGACGCCAGG - Intronic
1077441269 11:2570279-2570301 GCCAGAGGGCGTCCGACGCCAGG - Intronic
1077444824 11:2586077-2586099 CCCAGAGGGTGGGCGTTGCCGGG + Intronic
1078987062 11:16607081-16607103 CCGAGAGGGCGCGGGTGGCCGGG - Intronic
1080230887 11:30017011-30017033 CCCAGAGCGCGTTCGCGGCCAGG - Exonic
1080595999 11:33774606-33774628 CCCTGAGGGCGGGGCTGGCCCGG - Intergenic
1081567602 11:44269684-44269706 CCCAGTGGGCAGCCAGGGCCTGG - Intronic
1083722023 11:64607913-64607935 CCCAGAGGGCGGGCGGCGCGCGG + Exonic
1084192258 11:67504549-67504571 CCCAGAGGGATGCCGTTTCCCGG - Intronic
1084520504 11:69659795-69659817 CCCAGGCGGCCGCCGTGGCATGG - Intronic
1089257673 11:117202397-117202419 CCCAGAAGCAGGCCCTGGCCTGG - Exonic
1091195974 11:133731027-133731049 CACAGAGGGCAGCCGATGCCCGG + Intergenic
1202805260 11_KI270721v1_random:2904-2926 CCCAGGGGGCGGGCGTGGCCGGG + Intergenic
1202812783 11_KI270721v1_random:34457-34479 GCCCGAGGGCAGCCCTGGCCAGG - Intergenic
1096007320 12:48183798-48183820 CCCAGAGGGCGGCGCTGACACGG + Exonic
1098322354 12:69258796-69258818 CCAGGAGGGGGGCCGTAGCCTGG - Exonic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1103171203 12:118821526-118821548 TCCAAAGGGCAGCAGTGGCCTGG - Intergenic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1103798691 12:123523109-123523131 TCCAGGGGGCGGCCGTGCTCTGG - Intronic
1103856408 12:123973392-123973414 CCCGGAGGGAGGCGGGGGCCGGG + Exonic
1103934140 12:124466378-124466400 TCCTGTGCGCGGCCGTGGCCCGG - Intronic
1104148864 12:126062408-126062430 CCCAGGGGACAGCTGTGGCCAGG + Intergenic
1104595205 12:130115901-130115923 ACCAGAGGCCGGGCTTGGCCTGG + Intergenic
1104949809 12:132434330-132434352 CAGAGTGGGCGGGCGTGGCCTGG - Intergenic
1104983317 12:132583382-132583404 CCAAGAGGGCGGCGGAGCCCGGG - Exonic
1105011888 12:132761751-132761773 CCGAGTGGGCGGCGCTGGCCTGG - Exonic
1106587502 13:31070048-31070070 CCCAGTGGGTGGGCCTGGCCGGG - Intergenic
1112370394 13:98788377-98788399 CCCAGAGGGCCCTGGTGGCCTGG - Intergenic
1113579229 13:111417073-111417095 CCCTGAGGGATGCCGTGTCCCGG + Intergenic
1113604530 13:111595926-111595948 GCCAGAGGGTGGCCCTGACCTGG - Intronic
1114740520 14:25092268-25092290 CCCAGAAGGAGGCCATGGCCTGG + Intergenic
1116838774 14:49797867-49797889 CACAGATGGTAGCCGTGGCCAGG - Intronic
1117825773 14:59702212-59702234 CCCAGAGTGCTGCCGTGCACTGG + Intronic
1119261057 14:73238106-73238128 TGCAGAGGGGGGCCGTGGGCGGG + Intronic
1121252049 14:92506536-92506558 CCAAGAAGACGGCCCTGGCCTGG - Intergenic
1121343002 14:93116044-93116066 TCCTGGGGGCGGCCGTGGCCCGG + Intronic
1122296160 14:100706755-100706777 CACAGAGGGCGGCTGGGTCCCGG + Intergenic
1122807382 14:104266746-104266768 CCCAGAGGTGGGCAGGGGCCAGG + Intergenic
1122951824 14:105049264-105049286 TCCAGAGGACAGCCGTGACCAGG - Intergenic
1123017938 14:105384452-105384474 CCCAGAGTGCGGGTGAGGCCCGG + Exonic
1123125836 14:105945364-105945386 CCCAGAGGGCTGCTGGGTCCAGG + Intergenic
1127464507 15:59231194-59231216 GCCAGAGGGCTGCGGTGGGCAGG + Intronic
1128522058 15:68381948-68381970 CCCAGAGGTGGGGCGAGGCCTGG - Intronic
1128635499 15:69299626-69299648 CCCAGCTGGGGGCTGTGGCCGGG - Intronic
1131622218 15:94080265-94080287 CACAGATGGTGGCCCTGGCCAGG + Intergenic
1131830585 15:96352341-96352363 CCGAGAGGGCCGCGGAGGCCAGG - Intergenic
1131977452 15:97960816-97960838 CCCTGAGGTCGGCAGAGGCCCGG - Exonic
1132027866 15:98418135-98418157 CCCACAGAGCGGCTGTGGCTGGG - Intergenic
1132619010 16:855635-855657 CCCACAGGGCGGCTGCTGCCTGG + Intronic
1132663478 16:1071598-1071620 CCCAGCCTGCGGCCATGGCCAGG - Intergenic
1132748356 16:1446224-1446246 CCCCGAGGGCTGCCCTGCCCTGG - Exonic
1132776400 16:1597204-1597226 CCCAGAAGGCGTGAGTGGCCTGG + Intronic
1132902871 16:2267940-2267962 CCCGCAGTGCGGCGGTGGCCTGG - Intronic
1132994748 16:2817201-2817223 CCCAGGGGGCGCCCCGGGCCCGG + Intronic
1134185105 16:12078849-12078871 CTCAGAGGACTTCCGTGGCCTGG - Exonic
1134529972 16:14975362-14975384 CCGGGAGGGCGGCTGGGGCCCGG + Intronic
1134663062 16:15998601-15998623 CCCAAAGGGCGGCTGTGGGAGGG - Intronic
1135548542 16:23381178-23381200 CCCAGAGGCCAGCCAAGGCCAGG - Exonic
1138125166 16:54432739-54432761 CACAGAGGGCGGCCGGGCCAAGG + Intergenic
1139433765 16:66924994-66925016 CCCTGACGGCGGCCGCGGCCGGG - Exonic
1139805881 16:69565589-69565611 CCCAGAGGCCGGCGGCGGACGGG - Intronic
1139866375 16:70065592-70065614 CCGGGAGGGCGGCTGGGGCCCGG - Intergenic
1140405673 16:74709600-74709622 ACCAGAGGGCAGCAGAGGCCGGG + Intergenic
1141518573 16:84562697-84562719 CCCAGGGTGCGGCCCTGGCTGGG - Intergenic
1141834861 16:86532029-86532051 CCCTGAGGGTGGCGCTGGCCAGG - Exonic
1141842067 16:86579582-86579604 CCCAGACGGCCGCCGGGCCCAGG - Exonic
1142145602 16:88491662-88491684 CCCTGAGGCCGGCCGTGGTTTGG + Intronic
1142150373 16:88509995-88510017 CCCAGGGGGCAGCCCTGGGCTGG + Intronic
1142162854 16:88567969-88567991 CCCAGGGGGCGGAGGTGGCAGGG + Intergenic
1142278336 16:89134627-89134649 CAGAGAGGGCAGCCGTTGCCAGG + Intronic
1142519395 17:494313-494335 CCCAGGGAGCACCCGTGGCCTGG + Intergenic
1142549918 17:732362-732384 CCGAGGCGGCGGCTGTGGCCGGG - Intergenic
1142864312 17:2781097-2781119 ACCAGAGCGTGGCCGGGGCCAGG - Intronic
1142977727 17:3655765-3655787 CCCAGGAGGCCGACGTGGCCAGG - Intronic
1144559819 17:16312274-16312296 CCCAGACGGGGGTCGCGGCCGGG + Intronic
1144865445 17:18332621-18332643 CCCAGAGTGGGGCCCTGACCTGG + Intronic
1144953343 17:19005334-19005356 CCAAGAGGGCCGCTGTGGGCTGG + Intronic
1147168721 17:38606118-38606140 CGCAGCGCGCGGCCGGGGCCGGG + Intergenic
1148193013 17:45692905-45692927 CCCAGAGGGAGGCCTGAGCCAGG + Intergenic
1148493454 17:48037739-48037761 CCCCGGGTGCGGACGTGGCCAGG + Exonic
1150221096 17:63496367-63496389 AGCAGAGCGAGGCCGTGGCCCGG - Intronic
1152039360 17:77892974-77892996 CTCTGAGGGCTGCCCTGGCCAGG + Intergenic
1152087695 17:78230771-78230793 CCCAGAGAGGGGCTGTGGTCAGG + Intergenic
1152205670 17:78973261-78973283 CCCAGAGAGTGGCAGTGCCCCGG - Intronic
1152353964 17:79797863-79797885 CCCGGAGGGTGGCCGAGGGCAGG - Intronic
1152388204 17:79987680-79987702 CGCAGAGGGAGGCTGTGGCTGGG - Intronic
1152390472 17:80001202-80001224 CCCAGAGAGTGGCCGATGCCAGG - Intronic
1152538752 17:80964349-80964371 TACAGCAGGCGGCCGTGGCCTGG - Exonic
1152736440 17:81999684-81999706 CCCAGGGGACAGCCGAGGCCGGG - Intronic
1152763136 17:82119927-82119949 CTCAGAGGTTGGCCGTGCCCTGG + Intronic
1153514429 18:5891171-5891193 CCCCGAGGGCGGCCGCCGCTCGG + Exonic
1154129711 18:11726517-11726539 CCCAGAGAGGGGCAGAGGCCTGG - Intronic
1156491909 18:37501402-37501424 CCCAGAGGGCTGCCAGGGTCTGG - Intronic
1156880303 18:42069520-42069542 CACAGAGATGGGCCGTGGCCAGG - Intronic
1157442996 18:47724502-47724524 CCCACCGGCCGGCAGTGGCCTGG + Intergenic
1157711638 18:49853681-49853703 CTCAGATGGGGGCCCTGGCCTGG - Intronic
1159044261 18:63353844-63353866 CCCATAGGGCGGCCCTCACCTGG - Intronic
1159369873 18:67516561-67516583 TCCTGAGGGCGGGCGTGTCCGGG - Exonic
1160543353 18:79637764-79637786 CCCAGAGGCAGCCCCTGGCCGGG - Intergenic
1160788251 19:911918-911940 CCCAGAGGGCGAGTGGGGCCGGG + Intronic
1161153715 19:2721749-2721771 CCCTGAGGCCGGCTGGGGCCCGG + Intronic
1161237474 19:3205074-3205096 CCAAGACGGTGGCCGGGGCCAGG - Intronic
1161272485 19:3397708-3397730 CCCAAGGGGCGGGTGTGGCCAGG - Intronic
1161314691 19:3612436-3612458 CCCAGGGGGAGGCCGAGGCCCGG - Intronic
1161380841 19:3964210-3964232 CCCAGTGGGCAGCCCCGGCCTGG - Intronic
1162130402 19:8522678-8522700 CTCTGAGGGCGGACGTGCCCGGG + Exonic
1163368675 19:16889913-16889935 CATAGAGTGCGGCCGTGGCCAGG - Exonic
1164642147 19:29833774-29833796 TCAAGGGGGCGGCGGTGGCCGGG - Intergenic
1165013328 19:32864093-32864115 CACAGATGGCGGCGGCGGCCAGG + Exonic
1165101108 19:33439281-33439303 CCCAGAGGGAGGCAGGGGGCAGG - Intronic
1166079341 19:40434029-40434051 CCCGGGAGGCGGCCGCGGCCGGG - Intergenic
1166340784 19:42135373-42135395 CCCAGAGGCTGCCCCTGGCCTGG - Intronic
1166369889 19:42294825-42294847 CCTGGAAGGCGGCTGTGGCCTGG - Exonic
1166719008 19:44986929-44986951 CCCACAGGGCAGCCGTGGGCTGG + Intronic
1167069145 19:47209563-47209585 CCCAGAGGGCTGGCGAGGCCGGG - Exonic
1167138688 19:47634255-47634277 CCCAGAGCGAGGCCATGGCTGGG + Intronic
1167148374 19:47695446-47695468 CCCGGAGGGCTTCCCTGGCCCGG - Exonic
1167376322 19:49114308-49114330 CGCAGGGGGCGCCCGTGGCCCGG + Intronic
1167685447 19:50953019-50953041 CCCAGGAGGAGGCAGTGGCCAGG - Exonic
1167830962 19:52022381-52022403 CCCAGATGGCGGCGGTGGTGTGG - Intronic
925394023 2:3519408-3519430 CCCACTGGGCGGCCGGGGTCGGG + Exonic
925401873 2:3580059-3580081 CCCAGAGGGCAGGCGTTGCTAGG + Intronic
925447888 2:3943210-3943232 TCCTGAGGTCGGCCGGGGCCAGG + Intergenic
926084055 2:10010048-10010070 CCCATAGGCCAGCCCTGGCCTGG - Intergenic
926104468 2:10141759-10141781 CCCAGGAGGTGGCCATGGCCTGG + Intronic
927210312 2:20635035-20635057 CCCTGAGGGCGGGGGTGGGCAGG + Intronic
928086289 2:28348296-28348318 CCCAGAGGCTGGCTGAGGCCGGG - Intergenic
930011529 2:46941418-46941440 CGCAGACGGCAGCCGGGGCCCGG - Exonic
932620891 2:73264493-73264515 CCCCGAGGGAGGCAGTGGGCGGG - Exonic
932773663 2:74514896-74514918 CCCAGGGGGCGGTCTAGGCCTGG + Exonic
933942301 2:87254727-87254749 CCCAGTGGGTGGCTGTGGCCTGG - Intergenic
934670393 2:96208724-96208746 TCCAGCGGGCGCCCGGGGCCGGG + Exonic
934735073 2:96685929-96685951 GGCAGAGGGCGCCTGTGGCCAGG - Intergenic
935234294 2:101125193-101125215 CCCAGGGGGCACCCGGGGCCAGG + Intronic
935692578 2:105744760-105744782 CCCAGGGGCCGGCCCAGGCCCGG - Intergenic
936337925 2:111606842-111606864 CCAAGTGGGTGGCTGTGGCCTGG + Intergenic
940035745 2:149310579-149310601 CCCAGTGGGCTGCGGCGGCCGGG - Intergenic
942071981 2:172324469-172324491 CCCAGGGGCTGACCGTGGCCGGG + Intergenic
945043705 2:205763789-205763811 CCCCGCGGCCGCCCGTGGCCTGG - Exonic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
947793313 2:232879747-232879769 CACAGATGGGGGCCCTGGCCAGG - Intronic
947992480 2:234497700-234497722 TCCGGAGGGCGGCGCTGGCCGGG - Intergenic
948257809 2:236580720-236580742 CCCACAGGTCGGCAATGGCCAGG - Exonic
948368702 2:237474454-237474476 CCCAGAGCGGGGCAGGGGCCAGG + Intergenic
948776209 2:240290249-240290271 CCCAGAGGCAGGACCTGGCCAGG - Intergenic
948822529 2:240557404-240557426 CTCAGAGGGCGCCCGAGGCCCGG + Intronic
948990450 2:241551349-241551371 CCCAGAGAGAGGCCGGGGCCTGG + Intergenic
949023085 2:241752300-241752322 CCCAGAGGACGCCCCTGGGCTGG - Intronic
1170524752 20:17226827-17226849 CCCAGAAGGCGGAGGCGGCCGGG + Intronic
1170596497 20:17809891-17809913 CCCAGAGGCCTGCTGTGGCTCGG + Intergenic
1171278751 20:23879614-23879636 CCTTGATGGTGGCCGTGGCCGGG - Exonic
1171391547 20:24804656-24804678 ACCCGAGGGAGGCCATGGCCTGG + Intergenic
1171427484 20:25057883-25057905 CCCAGAAGGCGGCCGGCTCCCGG + Exonic
1172304408 20:33871094-33871116 CCCAGAGGCAGCCCCTGGCCTGG - Intergenic
1172474635 20:35227165-35227187 CGCCGAGGGCCGCCGAGGCCGGG + Intronic
1172512738 20:35511849-35511871 CCCAGAGGGGTGCCTTGCCCTGG + Exonic
1174436496 20:50510656-50510678 CCCAGAGGGAGTCTGGGGCCTGG - Intronic
1175869546 20:62201889-62201911 CTCAGAAGGCGGCCGTGGCATGG + Exonic
1175909618 20:62398559-62398581 CCCTGAGGACGGCGCTGGCCTGG - Intronic
1176054260 20:63135509-63135531 CCCAGAGGGGAGGCGGGGCCCGG + Intergenic
1176062608 20:63178903-63178925 CGCAGAGGGCGGCGGGGCCCGGG + Intergenic
1176097954 20:63352894-63352916 CCCAGAGGGCGGCTGGAGCCAGG - Intronic
1176261904 20:64186264-64186286 CCCAGAGGGCGGCGCTGGCTGGG - Intronic
1176299054 21:5090056-5090078 CCCAGAAGGCTGCCCTGGGCCGG + Intergenic
1178487009 21:33025696-33025718 ACCAATGGGCGCCCGTGGCCGGG - Intergenic
1179458999 21:41521067-41521089 CCCAGAGGGAGGCAGTTGCAGGG + Intronic
1179584870 21:42368019-42368041 CCCAGGGAGGGGCCGAGGCCTGG + Intergenic
1179795256 21:43778762-43778784 ACCTGAGGGAGGCTGTGGCCTGG + Intergenic
1179857971 21:44171892-44171914 CCCAGAAGGCTGCCCTGGGCCGG - Intergenic
1179885980 21:44314445-44314467 CCCTGAGGGCGGTCGGGGCCCGG + Intronic
1179983248 21:44907283-44907305 CCCAGGGGTCTGCTGTGGCCGGG - Intronic
1180177084 21:46096095-46096117 CACATAGGCCAGCCGTGGCCAGG + Intergenic
1180986863 22:19910100-19910122 ACCAGAGGGCGGCAGAGGCTTGG - Intronic
1180988249 22:19918105-19918127 CCCAGAGGGCGGCCCATTCCCGG + Intronic
1181325569 22:22043236-22043258 CCCAGTGGGTGGAGGTGGCCTGG - Intergenic
1181462931 22:23095950-23095972 TCCTGAGGGCGGCCAGGGCCCGG - Exonic
1181563146 22:23717269-23717291 CCTGGGGGGCGGCAGTGGCCTGG - Intergenic
1181774121 22:25147537-25147559 CCCAGGGGGAGGGCATGGCCAGG - Intronic
1182119090 22:27775323-27775345 TCCAGAGGGTGGGAGTGGCCAGG + Intronic
1182236971 22:28883726-28883748 CGCGGAGGGCGGGCGCGGCCGGG - Exonic
1182331360 22:29553574-29553596 CCCAAAGGGCGCCCCTGGGCTGG - Intronic
1183162745 22:36126041-36126063 CCCAGAGGCCAGCAGAGGCCAGG - Intergenic
1183260326 22:36790667-36790689 CCCTGAGGGAGGCTGGGGCCAGG + Intergenic
1183484736 22:38082816-38082838 CCCAGACGGCGGCTGGGGCTGGG - Exonic
1183546688 22:38457919-38457941 CCCAGGGTGCGGCCCAGGCCCGG - Intergenic
1184274197 22:43400781-43400803 CCCACAGGGAGGCCATGGCACGG + Intergenic
1184740915 22:46428667-46428689 CCCAAGGGGCGGCAGTGCCCAGG + Intronic
1184809834 22:46823823-46823845 CCGGGAGTGCGGCCGTGACCAGG + Intronic
1185066228 22:48633001-48633023 CCCACAGGGCGCCAGGGGCCAGG - Intronic
1185145647 22:49134332-49134354 GGCAGAGGGCGGCCATTGCCCGG + Intergenic
1185275531 22:49948892-49948914 CCCTGAGGACAGCCCTGGCCAGG - Intergenic
949594804 3:5532354-5532376 CCCACAGGGCTGCCCTGGCAAGG - Intergenic
950471821 3:13191021-13191043 CCCACAGGACGGCCATGGCAAGG - Intergenic
950549681 3:13658710-13658732 GCCACAGGGTGGCCTTGGCCAGG - Intergenic
952301252 3:32106483-32106505 CCTGGAGGCCGGCCGGGGCCAGG + Intronic
954152108 3:48662761-48662783 CCCAGAGGGCGGCGGGGGTGCGG - Exonic
954325141 3:49859389-49859411 CCCAGAGGGCGCCACAGGCCAGG - Exonic
961540888 3:127598548-127598570 CCCAGAGCGCCGCCCTGGGCCGG - Intronic
963068326 3:141281481-141281503 CACTGAGGGCTGCCGTGTCCTGG - Intronic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
968051658 3:195658558-195658580 CACAGAGGGCGGCAGAGGCCCGG - Intergenic
968065653 3:195757591-195757613 CCCAAAGGGCAGCCCTGGCTGGG + Intronic
968104157 3:195989775-195989797 CACAGACGGCGGCAGAGGCCCGG + Intergenic
968302459 3:197627365-197627387 CACAGAGGGCGGCAGAGGCCCGG + Intergenic
968446910 4:656820-656842 CCCTGAGGCTGGCCCTGGCCCGG - Intronic
968504077 4:963984-964006 CACAGGGGCCGGCCGTGGCTGGG + Intronic
968659987 4:1794863-1794885 CGCGGAGGGAGGCCTTGGCCCGG + Intronic
968812009 4:2804412-2804434 CCCAAAAGGGGGCTGTGGCCTGG + Intronic
969285742 4:6200757-6200779 GCCAGCGGGCGGCCGGGGCAGGG + Intergenic
969677004 4:8619816-8619838 GCCTGAGGGCAGCTGTGGCCTGG + Intergenic
969716865 4:8871968-8871990 CCCCGAGCGCGGCCGCTGCCGGG + Intergenic
971476907 4:27081037-27081059 CCCAGAGGGCAGCTGTGGTTTGG - Intergenic
975702021 4:77075780-77075802 GCCATAGGGCGGCGGGGGCCGGG + Exonic
976226430 4:82798438-82798460 CTCTGAGGGCGGCGGCGGCCCGG - Exonic
985472576 5:54685-54707 CCCAGAAGCCGGAAGTGGCCGGG - Intergenic
985484028 5:139074-139096 CCCATAGGGTGGCCCTGACCAGG + Intergenic
985565200 5:612075-612097 CCTAGAAGGCGGCCGCGCCCAGG + Intergenic
985774080 5:1831634-1831656 CCCAGAGGGGGCCTGGGGCCTGG + Intergenic
987085033 5:14460314-14460336 CCCGGTGTGCCGCCGTGGCCTGG + Intronic
989744334 5:44809544-44809566 CACCGAGGGCGGCAGCGGCCAGG - Exonic
992836792 5:80649620-80649642 CACAGACGGTGGCCCTGGCCAGG - Intronic
997208196 5:132062546-132062568 CCGTGGGTGCGGCCGTGGCCAGG - Exonic
1000815705 5:165919401-165919423 CCCAGACGGGGGCGGTGGCCGGG - Intergenic
1003162406 6:3647204-3647226 CCCTGAAGGCGGGAGTGGCCGGG - Intergenic
1003544900 6:7051436-7051458 CCCCGAGGGCGGCTGCGGCGCGG + Intergenic
1003619277 6:7683524-7683546 CCCATAGGGCTGCAGGGGCCAGG + Intergenic
1004690236 6:17987308-17987330 GCGAGAGCGCGGCCGGGGCCGGG - Intronic
1004864491 6:19838692-19838714 CCCCGAGGGCTTCCGGGGCCAGG + Intronic
1006366755 6:33620893-33620915 GCCGCAGGGCGGCCGCGGCCAGG + Exonic
1006396222 6:33789101-33789123 CCGACAGGCCGGCCATGGCCAGG + Exonic
1006582503 6:35084969-35084991 CCCTGAGGGCGGCAGAGACCTGG - Intronic
1006615214 6:35321455-35321477 CCCACAGGCCAGCTGTGGCCAGG - Exonic
1007431553 6:41780054-41780076 GCCAGAGGGCGCTCCTGGCCAGG + Intronic
1011075087 6:83430741-83430763 CCCGGTGAGCGGCCGCGGCCTGG - Intronic
1016949498 6:149566379-149566401 GGCAGAGGGCAGCCGCGGCCGGG - Exonic
1017497682 6:154995690-154995712 CCCGGAGGGCGGCAGCGTCCGGG + Intronic
1017725716 6:157274856-157274878 AGCAGAGGGCGGCCGAGGCGCGG - Intergenic
1018698969 6:166412295-166412317 CCCAGAGGGCTGGGGTGACCTGG - Exonic
1018913880 6:168120993-168121015 CCCAGAGGCCGTGGGTGGCCAGG + Intergenic
1018915340 6:168129418-168129440 GTCAGATGGCGGCCGGGGCCGGG + Intergenic
1019145344 6:169972257-169972279 CCCAGACCTAGGCCGTGGCCCGG - Intergenic
1019299302 7:295523-295545 CCCAGAAAGCCGCCGTGGCCTGG - Intergenic
1019344307 7:522007-522029 CCCAGAAGGCGGCTGTCGCGCGG - Intergenic
1020210478 7:6154576-6154598 CCCAGAGAGCGGCGCTCGCCAGG - Exonic
1021638312 7:22712915-22712937 CCCAGAGGGCTGAAATGGCCGGG + Intergenic
1024981582 7:55161533-55161555 CCCCGAGGGCTGCTGGGGCCCGG + Exonic
1025097293 7:56106280-56106302 CGCAGAGGGAGGCCGCGGGCGGG - Intronic
1025992020 7:66503884-66503906 CTCAGTGTGCAGCCGTGGCCTGG + Intergenic
1028453522 7:91013217-91013239 CCCTAAGGGAGGCCGTGGGCAGG - Intronic
1028850062 7:95527958-95527980 CCCAGTAGGCGGCGATGGCCAGG - Exonic
1029287865 7:99478626-99478648 CCCAGAGGGCTGCAGTGGTGTGG + Intronic
1029403228 7:100358164-100358186 CCCAGAGGGCTGTGGGGGCCGGG - Intronic
1029599856 7:101557383-101557405 CCCAGAGGGAGGTTCTGGCCAGG + Exonic
1030176602 7:106660830-106660852 CGCCCCGGGCGGCCGTGGCCGGG + Exonic
1034418344 7:150976765-150976787 CCCAGGGGGAGGCTGTGGGCGGG - Intronic
1034456279 7:151172686-151172708 ACCAGAGGGCACCCGCGGCCAGG - Intronic
1035293444 7:157854404-157854426 GCCAAAGAGCAGCCGTGGCCAGG + Intronic
1035442247 7:158911093-158911115 CACAGAGGTTGGCTGTGGCCTGG + Intronic
1035605333 8:926635-926657 CCGCCTGGGCGGCCGTGGCCAGG + Intergenic
1035828295 8:2668197-2668219 CCCAGAGGGTGGCAGGGGCGGGG + Intergenic
1036664778 8:10731055-10731077 CACAGAGGCCGGCCGGAGCCGGG + Intronic
1036826256 8:11978346-11978368 CCCAGATGGCTGCAGTGGCTCGG - Intergenic
1039903071 8:41766996-41767018 CCCCGAGGGGGGCCGGGCCCTGG - Intronic
1047347971 8:124046924-124046946 CCCAGAGGGAGGGAGTGGCTTGG - Intronic
1047732291 8:127737378-127737400 ACCCGAGGGCGGCCGCGGCAGGG - Intronic
1048445533 8:134490050-134490072 CCCAGAGGGCTACCCCGGCCAGG + Intronic
1049211188 8:141387162-141387184 CCCTGGGGGTGACCGTGGCCAGG - Intergenic
1049434250 8:142579191-142579213 CGCAGAGGGAGGCCATTGCCGGG + Intergenic
1049612428 8:143561769-143561791 GCCAGAGGGCAGCTGTGGCCAGG - Exonic
1049987988 9:970173-970195 CCCAGCGGGAGGGCGGGGCCCGG + Intergenic
1051355662 9:16237898-16237920 ACCAGAGGACGGCGGTGGCGGGG + Intronic
1053152206 9:35750236-35750258 CCCACAGTGAGGCCCTGGCCTGG + Exonic
1053411092 9:37916594-37916616 CTCACAGGGCGGCTGTGGGCCGG - Intronic
1057232903 9:93335621-93335643 CCCAGGGGGCGCCCCGGGCCAGG - Exonic
1057252609 9:93516000-93516022 CCCAGGGGGCGCCCCGGGCCAGG + Exonic
1057259856 9:93577228-93577250 TCCGGAGGGAGGCCGAGGCCCGG + Intronic
1058731101 9:107850684-107850706 CCCACAGAGCGGCCATGACCAGG - Intergenic
1060112511 9:120916769-120916791 GGCAGAGGGCGGCCTTGGCAGGG + Intronic
1060855954 9:126915098-126915120 CCCCGAGGGCCGCCGAAGCCGGG + Intronic
1061583984 9:131554764-131554786 CCCAGGCGGCGGGCGAGGCCGGG + Intergenic
1061623111 9:131824412-131824434 CCCAGAAGGCAGCGGTGCCCAGG - Intergenic
1061818051 9:133207901-133207923 CCCAGAGGGCAGGCGTGATCTGG + Intronic
1062037562 9:134389490-134389512 CCCAGAGGGCTAGCGGGGCCAGG + Intronic
1062110782 9:134781000-134781022 CCCCGCAGGCCGCCGTGGCCAGG - Intronic
1062439824 9:136564670-136564692 CCCAGAGGTGGGCCCTGACCTGG - Intergenic
1062520246 9:136954634-136954656 CCCAGAGGGAGGAGATGGCCCGG - Intronic
1062607512 9:137354815-137354837 CCCAGAAGGAGGCCGTGGTGAGG - Intronic
1062633291 9:137477067-137477089 CCCAGAAGGCAGCCCTGGCCTGG + Intronic
1185774956 X:2794583-2794605 ACCTGCAGGCGGCCGTGGCCTGG - Exonic
1191104542 X:56764361-56764383 CCCAGAGGGCGGAGCTGGCCCGG - Intergenic
1192847792 X:74924446-74924468 CCCACGCGGCGGCCGAGGCCGGG - Intronic
1196804841 X:119574761-119574783 CCGAGGGGACGGCCGAGGCCGGG + Intronic
1201416233 Y:13751726-13751748 CCCAGAGTGCGGCCCCGGCGAGG + Intergenic