ID: 1076816970

View in Genome Browser
Species Human (GRCh38)
Location 10:132919854-132919876
Sequence CGTGGCTGTCATCACAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076816965_1076816970 -6 Left 1076816965 10:132919837-132919859 CCGCACACCTCATAGGCCGTGGC 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1076816970 10:132919854-132919876 CGTGGCTGTCATCACAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 155
1076816958_1076816970 28 Left 1076816958 10:132919803-132919825 CCGAGTGACAGCAGTGACAGGCG No data
Right 1076816970 10:132919854-132919876 CGTGGCTGTCATCACAGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076816970 Original CRISPR CGTGGCTGTCATCACAGGCT GGG Intronic