ID: 1076819566

View in Genome Browser
Species Human (GRCh38)
Location 10:132931681-132931703
Sequence CTTCCTCCCCACACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076819555_1076819566 17 Left 1076819555 10:132931641-132931663 CCTGGGCCTCCCTACACTCCCCA 0: 2
1: 9
2: 7
3: 47
4: 471
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819558_1076819566 7 Left 1076819558 10:132931651-132931673 CCTACACTCCCCACACAGAGCCT 0: 8
1: 22
2: 9
3: 36
4: 403
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819562_1076819566 -2 Left 1076819562 10:132931660-132931682 CCCACACAGAGCCTGGGCCTTCT 0: 1
1: 18
2: 18
3: 59
4: 378
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819563_1076819566 -3 Left 1076819563 10:132931661-132931683 CCACACAGAGCCTGGGCCTTCTT 0: 1
1: 12
2: 29
3: 58
4: 370
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819557_1076819566 8 Left 1076819557 10:132931650-132931672 CCCTACACTCCCCACACAGAGCC 0: 4
1: 7
2: 20
3: 34
4: 333
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819561_1076819566 -1 Left 1076819561 10:132931659-132931681 CCCCACACAGAGCCTGGGCCTTC 0: 21
1: 19
2: 14
3: 46
4: 357
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data
1076819556_1076819566 11 Left 1076819556 10:132931647-132931669 CCTCCCTACACTCCCCACACAGA 0: 2
1: 4
2: 7
3: 57
4: 553
Right 1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076819566 Original CRISPR CTTCCTCCCCACACAGAGCC TGG Intronic
No off target data available for this crispr