ID: 1076820598

View in Genome Browser
Species Human (GRCh38)
Location 10:132936881-132936903
Sequence GAGCTCTGTCCCCTCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076820598 Original CRISPR GAGCTCTGTCCCCTCCATGG GGG (reversed) Intronic
900399125 1:2465845-2465867 GGCCTCTGTCCACTCCAAGGAGG + Intronic
900673392 1:3869607-3869629 GAGCTCCTACCCCTCCACGGTGG + Exonic
901511566 1:9720493-9720515 GGGCGCTGTCCTCTGCATGGAGG - Intronic
902378422 1:16041371-16041393 GACCTCTGTCCCGTGCTTGGTGG + Intergenic
902721803 1:18309005-18309027 GAGCTGCATCCCCTCCTTGGAGG - Intronic
905234193 1:36534570-36534592 GAGCTCTGGCACCTCGATGTTGG + Intergenic
906996030 1:50795253-50795275 GATCACTGCCCCCTCCATGATGG - Intronic
907190065 1:52640918-52640940 GGGCCCTCTCCCCTCCCTGGAGG - Intronic
907314498 1:53559730-53559752 GAGCTCCCTCCCGTGCATGGCGG - Intronic
907369779 1:53993155-53993177 GAGCCCTGTCCCTTCCAAGTTGG - Intergenic
908474986 1:64478617-64478639 GAGCTCTGTCCTATCCAGAGAGG + Intronic
912586770 1:110774142-110774164 GGTCTCTGTCTCCTCCATGAAGG - Intergenic
913646556 1:120861182-120861204 GACCTCTGTCTCCTCCATCCTGG + Intergenic
914080093 1:144401690-144401712 GACCTCTGTCTCCTCCATCCTGG - Intergenic
914174999 1:145270225-145270247 GACCTCTGTCTCCTCCATCCTGG - Intergenic
914529723 1:148511704-148511726 GACCTCTGTCTCCTCCATCCTGG - Intergenic
917972739 1:180219254-180219276 GAGCTCTGTCCCTCCGCTGGGGG - Intergenic
919616735 1:199817149-199817171 GGGCTCTTTCTCCTCCATGTTGG + Intergenic
919649578 1:200133343-200133365 GAGCTCTGTGCCATCCATAAAGG + Intronic
919833268 1:201556718-201556740 CAGCCCTGCCCCCTCCATAGAGG + Intergenic
920454302 1:206086542-206086564 GAATTATGTCCCCTCCACGGGGG + Intronic
922536085 1:226381979-226382001 GCATTCTGACCCCTCCATGGAGG - Intronic
922734840 1:227973385-227973407 GGCCTCTGTCTCCCCCATGGCGG - Intergenic
923000529 1:230003117-230003139 GAGCTCTGTCACCTGCACTGGGG - Intergenic
924437403 1:244054473-244054495 GAGGTCTGTCACCTCCGTGAGGG + Exonic
924452046 1:244187212-244187234 GAGCCCTCTCCCCTTCGTGGAGG - Intergenic
924740174 1:246790244-246790266 CAGCCCTCTCCCCTCCCTGGTGG - Intergenic
1063164766 10:3451299-3451321 GACCTCTTGCTCCTCCATGGTGG - Intergenic
1064656173 10:17558283-17558305 TCGCTCTGTCCCCTCCAGGCTGG - Intergenic
1064922373 10:20532832-20532854 GAGCTCTCTCTCCTCCATTTAGG + Intergenic
1065861708 10:29877533-29877555 AAACTCTGGCCCCTCCATGGGGG + Intergenic
1065927732 10:30450606-30450628 GAGCTTTCCACCCTCCATGGAGG - Intronic
1065954120 10:30677720-30677742 GACCTCTGTCCCCTCCCTCTAGG + Intergenic
1067213222 10:44279030-44279052 GAGCCCTCCCTCCTCCATGGGGG - Intergenic
1068150481 10:53124374-53124396 GAGTACTGTCCCCCCAATGGAGG + Intergenic
1069224429 10:65924294-65924316 GAGATCTGCCCTCTCCATAGCGG + Intronic
1069809531 10:71148141-71148163 GAGCACTCTCCCCTCCCTGAAGG - Intergenic
1071940638 10:90587851-90587873 GAGGGCTGTCCCCTCCAGGTGGG - Intergenic
1076407370 10:130221698-130221720 GGGCTCTGTTCCCTCGCTGGCGG + Intergenic
1076478542 10:130769040-130769062 GAGCTGGGTCCCCTTCATAGTGG + Intergenic
1076631578 10:131855187-131855209 GAGCTGTGCCCACTCCAGGGAGG + Intergenic
1076820598 10:132936881-132936903 GAGCTCTGTCCCCTCCATGGGGG - Intronic
1076876015 10:133215857-133215879 GAGCTCTGTCCCGGCCACGCTGG - Intronic
1077093271 11:789014-789036 GAGCATTCTCCCCTCCAAGGAGG + Intronic
1077138117 11:1011655-1011677 GCGCTCTGTCCCCAGGATGGTGG + Exonic
1077183746 11:1227518-1227540 GAGGACTGTGCCCTACATGGTGG + Intronic
1079115181 11:17635916-17635938 CAGGCCTGTCCCCTCCATGGAGG + Intronic
1080747356 11:35120144-35120166 CAGCTTAGTCCTCTCCATGGAGG - Intergenic
1081686790 11:45048595-45048617 GAGCTCTGTCCCCTTGACCGTGG - Intergenic
1081915641 11:46728539-46728561 CAGCCCTATCCCCTCCCTGGTGG + Intronic
1083595281 11:63916021-63916043 GACCTCAGTCCCCTGCAAGGTGG + Intronic
1084195737 11:67522993-67523015 CAGCTCTGTCTCCTAGATGGAGG + Intronic
1084486223 11:69449824-69449846 CTGCTCTGTCCCCACCACGGAGG + Intergenic
1084754368 11:71225663-71225685 CATCTCTGTCACCTCCATGTTGG - Intronic
1084786451 11:71444431-71444453 GAGCTCTGGGCCTTCCATGGGGG - Intronic
1087172779 11:95067444-95067466 CAGCTCCGCCCCGTCCATGGCGG - Exonic
1088264136 11:107973716-107973738 GATCTCTGCCCCTTCCATGATGG + Intergenic
1088713335 11:112527512-112527534 GAGCCCTTCCCACTCCATGGAGG + Intergenic
1088924045 11:114282690-114282712 GAGCTCTCTCCCCTCCTCTGAGG + Intronic
1089205706 11:116760793-116760815 GTCCTCTGTCTCCTCCTTGGTGG + Exonic
1092191956 12:6527782-6527804 GAGCTCTGAGACCACCATGGAGG + Exonic
1093025031 12:14237877-14237899 GGGCTCTGTCCCTTCAATGAAGG - Intergenic
1096547162 12:52348024-52348046 AATCTCTGACACCTCCATGGTGG + Intergenic
1096946861 12:55416099-55416121 GAGGTCTTTCACCTCCTTGGTGG + Intergenic
1097384496 12:58933530-58933552 GAGCACAGTCCTCTCCTTGGGGG + Intergenic
1098659275 12:73072454-73072476 GTGCCCTGTCCCCTCCATGCTGG - Intergenic
1098991909 12:77072935-77072957 GAGCTCTGTATCCTCCATCAAGG + Intergenic
1100131371 12:91498146-91498168 GATCTCTGTACCCACCATAGAGG - Intergenic
1103275847 12:119711454-119711476 CAGCTGTGTCCCCTCCAGGAAGG - Intronic
1104844307 12:131839044-131839066 GAGCTCTCTCCCCACTCTGGAGG + Intronic
1106303773 13:28493755-28493777 GGGCTTTGACCCCTCAATGGCGG + Intronic
1113827558 13:113268285-113268307 GGCCTCTGCCCCCTCCACGGAGG + Intergenic
1113917707 13:113884211-113884233 GAGCCCCATCCCCTCCAAGGCGG + Intergenic
1114631016 14:24159752-24159774 GTGCTCGGTCCCTTCCTTGGAGG + Intronic
1117981976 14:61350627-61350649 GTGTTATGACCCCTCCATGGGGG - Intronic
1120020574 14:79525377-79525399 GAGATTTGTGCCCTCCATGCAGG - Intronic
1120198367 14:81512189-81512211 GAGGTCTGTCCACATCATGGAGG - Intronic
1120745412 14:88147140-88147162 GAGCTCTGCCCCTTCCAAGTTGG + Intergenic
1122385580 14:101343562-101343584 CAGCTCTGTCTCCTCCTTTGAGG - Intergenic
1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG + Intronic
1123878073 15:24644940-24644962 AAACTCTGTCCCTTCCATGATGG + Intergenic
1123977636 15:25568148-25568170 GAGCTGTGTCAGCTCCGTGGAGG + Intergenic
1125532863 15:40424982-40425004 GGGCTCTGGCCACTCCAGGGTGG - Intronic
1125880110 15:43185952-43185974 GAGAGCAGTCCCCTCCGTGGGGG - Intronic
1126763738 15:51993021-51993043 AACCTCTCTCCCCTCCCTGGAGG + Intronic
1128111312 15:65077835-65077857 GAGCTATGGCCACTGCATGGTGG + Exonic
1128672926 15:69587683-69587705 GAACTCTGAACCCTCCATGGGGG + Intergenic
1130270257 15:82442474-82442496 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1130275711 15:82475355-82475377 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1130462599 15:84169795-84169817 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1130468070 15:84202747-84202769 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1130485658 15:84396958-84396980 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1130490079 15:84424998-84425020 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1130496196 15:84470795-84470817 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1130501665 15:84503748-84503770 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1130590363 15:85207345-85207367 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1132152910 15:99475120-99475142 GAGCTCTGGCCCATCCCAGGGGG - Intergenic
1135293736 16:21261902-21261924 GAGCTCCTTCCCCTACAAGGAGG + Intronic
1137380377 16:47993055-47993077 CACCTCTGTCCCCTTCCTGGAGG - Intergenic
1137519679 16:49181611-49181633 GAGCTCAGTCTCCTTTATGGTGG - Intergenic
1137704949 16:50528536-50528558 GTGCTCTGCCCTCTCCATGGTGG + Intergenic
1139601675 16:67991173-67991195 GAGCTCTCTGCCCTGCAGGGTGG + Exonic
1139924439 16:70478462-70478484 GAGCTCTGGCCCCAGCATGAGGG + Intronic
1141935563 16:87235952-87235974 GTGCTCTGTCCTCTGCCTGGAGG - Intronic
1142761764 17:2046310-2046332 GAGCTTGCTCCCCTCCCTGGTGG - Intergenic
1143658259 17:8310035-8310057 GGGGTCTGTCTCCTCCAGGGAGG - Intergenic
1144263654 17:13547412-13547434 GCCCTTTCTCCCCTCCATGGAGG - Intronic
1146400672 17:32497910-32497932 CTGCTCAGTCCCCTCCCTGGTGG + Intronic
1146521569 17:33529365-33529387 GCGCTCTGTACCATCCTTGGTGG - Intronic
1147307379 17:39573493-39573515 GGCCTCTTTCCCCTCCATTGCGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1147588329 17:41665765-41665787 GACCTCTGTCACCTGGATGGTGG + Intergenic
1150189678 17:63224771-63224793 GACCTCTCTCCACTCCCTGGAGG - Intronic
1150336144 17:64332123-64332145 TGGCTCTGTTCCCTCTATGGGGG - Intronic
1151766456 17:76135789-76135811 GAGCTCACTCCCTTCCCTGGTGG + Intergenic
1151847503 17:76667568-76667590 GAGGACTGCCCCCTCCACGGGGG - Intergenic
1152001675 17:77649820-77649842 GAGCTCAATCTCCTCCCTGGAGG - Intergenic
1157200153 18:45653188-45653210 GAGGTCGGTCGCCTGCATGGAGG - Intronic
1159516326 18:69463155-69463177 TAGCTGTGTCCTCGCCATGGTGG + Intronic
1161064528 19:2231151-2231173 TGGCTCTGTGCCCTCCCTGGAGG + Exonic
1161216045 19:3095472-3095494 GAGCCCTGTACACTCCATGCAGG + Intronic
1161276921 19:3423580-3423602 GAGCCCTGACCCCTCCACGGAGG - Intronic
1161286521 19:3471267-3471289 CAGCTCTGTCCCCTCCAGACTGG + Intergenic
1162344946 19:10113510-10113532 GAGTTCTTTCCCCTCCCTGGAGG - Intronic
1162451180 19:10756167-10756189 GGGGTCTGTCACCTGCATGGGGG + Intronic
1162500397 19:11050269-11050291 GAGCTCTGGCCCCACCAGGCGGG + Intronic
1163001672 19:14372209-14372231 GGGCTCTGTCCCTTGGATGGAGG - Intergenic
1163171591 19:15535279-15535301 CAGCTCTATGCCCTCCCTGGAGG - Intronic
1163427778 19:17248428-17248450 GAGCACAGTCCCCTCCAGCGAGG - Intronic
1163625475 19:18386965-18386987 CATCTCTGTGCCCTCCATGGAGG + Intronic
1164027511 19:21366105-21366127 GAGCTCTTTCCCCTCCAAAAGGG - Intronic
1166080572 19:40441748-40441770 GGGCTCAGTCCCATCCATGGAGG + Exonic
1166340206 19:42132698-42132720 GACTTCTGTCGCCCCCATGGAGG + Intronic
1167368308 19:49065930-49065952 GGGCTCTGTCCCCTTCTCGGGGG - Intergenic
925146444 2:1586174-1586196 GATTTCTGTTCCTTCCATGGTGG - Intergenic
926035093 2:9630435-9630457 CAGCTCAGTCTTCTCCATGGCGG + Exonic
927077654 2:19596075-19596097 GAACTCTGTGGCCTACATGGAGG + Intergenic
927243216 2:20936571-20936593 GATGTCTGTCTCCTCCAAGGAGG - Intergenic
932551569 2:72775215-72775237 GGGCTCTCTCCCCTCCCTGGAGG + Intronic
933616535 2:84487560-84487582 GAGTTCTGTCTCCTCCATCCAGG - Intergenic
935140779 2:100351001-100351023 CAGCTCCTTCCCCTCCATGTAGG - Intergenic
937299639 2:120831376-120831398 GAGCCCTGTAACCTCCAGGGAGG - Intronic
937917180 2:127105104-127105126 GGGCTGTGTCCCCTCCAAGGAGG - Intronic
938120653 2:128631040-128631062 GAGGTCTGTGCCCTCCGTAGGGG - Intergenic
944316805 2:198292995-198293017 GAGCTCTGTCACCATCCTGGTGG + Intronic
945701338 2:213174557-213174579 GAATTCTGTCCTCTCCCTGGGGG - Intergenic
946242894 2:218367703-218367725 GGGCTCTGTCCCCTGCCAGGAGG + Exonic
946747967 2:222864326-222864348 GAGCTCTTGCCTCTACATGGAGG - Intronic
947024724 2:225724385-225724407 GGGCTTTGTCCAATCCATGGAGG + Intergenic
948947436 2:241228219-241228241 CAGCTCAGTCACCTCCGTGGCGG + Exonic
1171202887 20:23256060-23256082 AGGCTCCCTCCCCTCCATGGAGG + Intergenic
1172961835 20:38805637-38805659 GAGCTCAGGCCCCGCCTTGGGGG + Intergenic
1173893750 20:46534158-46534180 GAGCCCTGCCCCCTCCAAGTTGG + Intergenic
1174280426 20:49435076-49435098 GAGGCCTGTCCCCACCAGGGTGG + Intronic
1174632498 20:51970077-51970099 GAGCTCTGTCCAGTCCCTGATGG + Intergenic
1175312214 20:58019792-58019814 GAGCACTCTCCGCTCCAAGGAGG - Intergenic
1175704291 20:61164657-61164679 GAGGTCTTGCCCCTCCATGCAGG + Intergenic
1178246314 21:30956373-30956395 GAGCCCGGTCTCCTACATGGTGG - Intergenic
1179527940 21:41996038-41996060 GGGCTGTGTCCCCTCCATGAGGG + Intronic
1180325224 22:11367541-11367563 GAGCCCTTTGCCCTCTATGGTGG + Intergenic
1181165699 22:20981920-20981942 GAGCCCGGAACCCTCCATGGGGG + Intronic
1181820013 22:25468379-25468401 GGGCTCTATCCCACCCATGGTGG + Intergenic
1184112621 22:42404137-42404159 GAGCTCCGTGCCCTCCCTGCTGG + Intronic
1184147792 22:42621708-42621730 CAGCACTGGCCCCTCCCTGGGGG + Intronic
1184384247 22:44165330-44165352 GGGCTTTGTCCCCTGCATGCCGG + Intronic
1185034530 22:48465069-48465091 GAGCTCTGTCCACTCAACGCAGG - Intergenic
1185061741 22:48610575-48610597 GGGCTTTGTCCCCAGCATGGAGG + Intronic
1185370054 22:50456746-50456768 GAGCTCAGCCCCCTCCCTGGAGG - Intronic
952244711 3:31574447-31574469 GAACTTTGTCACTTCCATGGTGG + Intronic
953576498 3:44116937-44116959 CAGCTTTGTCCCCTTCATGCTGG - Intergenic
954148371 3:48645479-48645501 GAGCTCTGCCACCCCCAGGGCGG + Exonic
961655854 3:128441353-128441375 GAGCTGCTGCCCCTCCATGGGGG + Intergenic
965211064 3:165790190-165790212 CAGCTCCTTCCCCTCCATGGAGG - Intronic
966974146 3:185070230-185070252 CACCTCTGTCCCCTCCAGAGGGG - Intergenic
968312061 3:197692116-197692138 GATCCCTCTCCCCTCCCTGGAGG - Intronic
968462147 4:731501-731523 GTGCTCTGTCCCCTCGTGGGTGG + Intronic
968660879 4:1798239-1798261 CAGCCCTGGCCCCTCCCTGGGGG - Intronic
968812067 4:2804629-2804651 GAGCCCTGCCCCCTCCACAGAGG + Intronic
975910129 4:79258101-79258123 GAGCCCTGTCCCTTCCAAGTTGG + Intronic
976154262 4:82125677-82125699 CAGCCCTGCACCCTCCATGGTGG + Intergenic
980738113 4:136917459-136917481 GAGCCCTGACCCTTCCAAGGTGG + Intergenic
981575688 4:146202732-146202754 GAGCCCTGTCTCCTCCATCCTGG + Intergenic
985520469 5:371857-371879 GAGTTCTGTCCCTTCCAACGAGG + Intronic
987476102 5:18394002-18394024 GATCTCCGTCCCCTCCAGGCTGG + Intergenic
990985439 5:61637194-61637216 CAGCTCTGTGCCTGCCATGGAGG + Intergenic
993109355 5:83636932-83636954 GAGCTTTCTCTCCTCCCTGGGGG + Intergenic
994245525 5:97471660-97471682 GAGCCCTGTCCCTTCCAAGTTGG - Intergenic
997260094 5:132459298-132459320 GAGCTGTGTCCCATTCATGTTGG - Intronic
997381359 5:133440604-133440626 GAGCTGGGTCACCTCCCTGGAGG + Intronic
1002342140 5:178524223-178524245 CAGCTCTGTTTCCTCCATGTTGG + Intronic
1002959875 6:1904809-1904831 AAGCCCTGTTCCCTCCTTGGGGG + Intronic
1005505474 6:26465574-26465596 GAGCTGTGTCCTTTCTATGGTGG - Intronic
1006456116 6:34133001-34133023 GAGCTCGGTCTCCATCATGGTGG - Exonic
1007754502 6:44090242-44090264 GAAATCTATCCCCTCCATGGTGG - Intergenic
1012476185 6:99616824-99616846 CAGCTCTTTCCTTTCCATGGAGG + Intergenic
1019277601 7:184097-184119 GTTCTCTGTCTCCTCCATGGAGG + Intergenic
1019490334 7:1310218-1310240 CAGCTATGGCCCCTCCCTGGAGG + Intergenic
1024224961 7:47319540-47319562 GATATTTGTCCCCTCCATGGGGG - Intronic
1024758177 7:52561758-52561780 CAGCTCTGTCCCATTCATTGTGG + Intergenic
1028423756 7:90663137-90663159 GAGTTCTGTTACCTCCATGTAGG + Intronic
1035121967 7:156576476-156576498 GAGCTTTGTCCCCTCCAAATAGG + Intergenic
1035711144 8:1715565-1715587 TTGCTCTGTCGCCTCCATGCAGG + Intergenic
1039829497 8:41201610-41201632 AGGCTCAGTCCCCTCCATGATGG - Intergenic
1040944705 8:52872406-52872428 TAGCTCTGTCCCCTCCTTTTGGG + Intergenic
1041267059 8:56075482-56075504 GAGCTCTGACCCCTCCGTCCAGG + Intergenic
1044406569 8:91833581-91833603 GAGTGCTGTCCTCTCCCTGGAGG - Intergenic
1045286587 8:100796905-100796927 TAACTCTGTGCCATCCATGGTGG - Intergenic
1045294724 8:100863083-100863105 GAGCTGCGGCCCCTCCACGGAGG + Intergenic
1045650972 8:104341447-104341469 GAGCCCTGTGCCCTCCATGCTGG + Intronic
1049017133 8:139928655-139928677 GAGGTCTGTCCCAGCCCTGGAGG + Intronic
1049344597 8:142131752-142131774 GAGATCTGTCCACTCCAGGGTGG - Intergenic
1049361685 8:142215071-142215093 GAGACCTGTCCTGTCCATGGAGG + Intronic
1049515798 8:143054607-143054629 GAGCGCTGTCCCTTCCAGAGTGG - Intronic
1052758541 9:32566626-32566648 GAGCTCCTGCTCCTCCATGGTGG - Intronic
1055761745 9:79616456-79616478 GAGCTCTGTCTCCTCTTGGGAGG + Intronic
1056011845 9:82340364-82340386 GCTTTCTGTCACCTCCATGGTGG + Intergenic
1057059132 9:91987571-91987593 AAACTCTGTCCCTTCCATGATGG - Intergenic
1061398102 9:130354401-130354423 GAGCTCTGTCCCGGCCCTGGGGG + Intronic
1061522645 9:131129359-131129381 CCCCACTGTCCCCTCCATGGTGG + Exonic
1062131467 9:134896300-134896322 GAGCCCTGTGCCTTCCATGACGG + Intergenic
1062530246 9:136996526-136996548 GAGCTTGGTCTCCGCCATGGTGG + Exonic
1186275225 X:7930926-7930948 GAGCACTGCCCTTTCCATGGGGG + Intergenic
1186391331 X:9162482-9162504 GTGCTATGTCACCTCCATGAAGG + Intronic
1187503844 X:19863059-19863081 GGACCCTGTCCCCTCCCTGGGGG + Intronic
1189502304 X:41574224-41574246 CAGCTCTGTCCCCTCAATTTAGG + Intronic
1195060685 X:101191420-101191442 CAGCTCCGTCTTCTCCATGGCGG + Intergenic
1198051505 X:132956842-132956864 CAGCTGTGTGCCCTCCGTGGTGG - Exonic
1198330294 X:135616732-135616754 CAGCCCTGTCCCTTCCATAGTGG + Intergenic
1198336633 X:135672267-135672289 CAGCCCTGTCCCTTCCATAGTGG - Intergenic
1198363018 X:135914516-135914538 CAGCCCTGTCCCTTCCATAGTGG + Intergenic
1201308356 Y:12570656-12570678 GAGCTGTGTTCCCTTCAAGGAGG - Intergenic
1202368148 Y:24180576-24180598 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1202372548 Y:24208606-24208628 GAGCTCTGTGCCCTCTCTGATGG - Intergenic
1202498236 Y:25461514-25461536 GAGCTCTGTGCCCTCTCTGATGG + Intergenic
1202502637 Y:25489541-25489563 GAGCTCTGTGCCCTCTCTGATGG - Intergenic