ID: 1076821872

View in Genome Browser
Species Human (GRCh38)
Location 10:132943484-132943506
Sequence CACCCACGAGAGTCCCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076821866_1076821872 -8 Left 1076821866 10:132943469-132943491 CCCCTGGGAGAGGCCCACCCACG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821867_1076821872 -9 Left 1076821867 10:132943470-132943492 CCCTGGGAGAGGCCCACCCACGA No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821857_1076821872 20 Left 1076821857 10:132943441-132943463 CCTGGGGTAGGCCCACCTGGGAG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821868_1076821872 -10 Left 1076821868 10:132943471-132943493 CCTGGGAGAGGCCCACCCACGAG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821863_1076821872 5 Left 1076821863 10:132943456-132943478 CCTGGGAGAGGACCCCCTGGGAG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821853_1076821872 24 Left 1076821853 10:132943437-132943459 CCCACCTGGGGTAGGCCCACCTG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821860_1076821872 8 Left 1076821860 10:132943453-132943475 CCACCTGGGAGAGGACCCCCTGG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821859_1076821872 9 Left 1076821859 10:132943452-132943474 CCCACCTGGGAGAGGACCCCCTG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821865_1076821872 -7 Left 1076821865 10:132943468-132943490 CCCCCTGGGAGAGGCCCACCCAC No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data
1076821854_1076821872 23 Left 1076821854 10:132943438-132943460 CCACCTGGGGTAGGCCCACCTGG No data
Right 1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076821872 Original CRISPR CACCCACGAGAGTCCCACGT GGG Intergenic
No off target data available for this crispr