ID: 1076825319

View in Genome Browser
Species Human (GRCh38)
Location 10:132964325-132964347
Sequence CTGCAGGTGGAGAGGAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825313_1076825319 -1 Left 1076825313 10:132964303-132964325 CCTCGACTGTCCAGGCTTGCAGC No data
Right 1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG No data
1076825310_1076825319 8 Left 1076825310 10:132964294-132964316 CCCGGGGTGCCTCGACTGTCCAG No data
Right 1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG No data
1076825311_1076825319 7 Left 1076825311 10:132964295-132964317 CCGGGGTGCCTCGACTGTCCAGG No data
Right 1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825319 Original CRISPR CTGCAGGTGGAGAGGAGGCA AGG Intergenic
No off target data available for this crispr