ID: 1076825399

View in Genome Browser
Species Human (GRCh38)
Location 10:132964788-132964810
Sequence GCTCACAGAGGGCAGGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825399_1076825408 4 Left 1076825399 10:132964788-132964810 CCTAGGCCCTGCCCTCTGTGAGC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825399_1076825405 -7 Left 1076825399 10:132964788-132964810 CCTAGGCCCTGCCCTCTGTGAGC No data
Right 1076825405 10:132964804-132964826 TGTGAGCCCAGGTCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825399 Original CRISPR GCTCACAGAGGGCAGGGCCT AGG (reversed) Intergenic
No off target data available for this crispr