ID: 1076825401

View in Genome Browser
Species Human (GRCh38)
Location 10:132964794-132964816
Sequence ACCTGGGCTCACAGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825401_1076825408 -2 Left 1076825401 10:132964794-132964816 CCCTGCCCTCTGTGAGCCCAGGT No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825401_1076825416 29 Left 1076825401 10:132964794-132964816 CCCTGCCCTCTGTGAGCCCAGGT No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825401 Original CRISPR ACCTGGGCTCACAGAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr