ID: 1076825403

View in Genome Browser
Species Human (GRCh38)
Location 10:132964799-132964821
Sequence GGGTGACCTGGGCTCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825403_1076825418 29 Left 1076825403 10:132964799-132964821 CCCTCTGTGAGCCCAGGTCACCC No data
Right 1076825418 10:132964851-132964873 TCCCTCCTCCCACTGTGGCCAGG No data
1076825403_1076825408 -7 Left 1076825403 10:132964799-132964821 CCCTCTGTGAGCCCAGGTCACCC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825403_1076825416 24 Left 1076825403 10:132964799-132964821 CCCTCTGTGAGCCCAGGTCACCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825403 Original CRISPR GGGTGACCTGGGCTCACAGA GGG (reversed) Intergenic
No off target data available for this crispr