ID: 1076825404

View in Genome Browser
Species Human (GRCh38)
Location 10:132964800-132964822
Sequence GGGGTGACCTGGGCTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825404_1076825408 -8 Left 1076825404 10:132964800-132964822 CCTCTGTGAGCCCAGGTCACCCC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825404_1076825416 23 Left 1076825404 10:132964800-132964822 CCTCTGTGAGCCCAGGTCACCCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825404_1076825418 28 Left 1076825404 10:132964800-132964822 CCTCTGTGAGCCCAGGTCACCCC No data
Right 1076825418 10:132964851-132964873 TCCCTCCTCCCACTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825404 Original CRISPR GGGGTGACCTGGGCTCACAG AGG (reversed) Intergenic