ID: 1076825405

View in Genome Browser
Species Human (GRCh38)
Location 10:132964804-132964826
Sequence TGTGAGCCCAGGTCACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825398_1076825405 -6 Left 1076825398 10:132964787-132964809 CCCTAGGCCCTGCCCTCTGTGAG No data
Right 1076825405 10:132964804-132964826 TGTGAGCCCAGGTCACCCCCAGG No data
1076825399_1076825405 -7 Left 1076825399 10:132964788-132964810 CCTAGGCCCTGCCCTCTGTGAGC No data
Right 1076825405 10:132964804-132964826 TGTGAGCCCAGGTCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825405 Original CRISPR TGTGAGCCCAGGTCACCCCC AGG Intergenic
No off target data available for this crispr