ID: 1076825406

View in Genome Browser
Species Human (GRCh38)
Location 10:132964810-132964832
Sequence GGGCGTCCTGGGGGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825406_1076825422 23 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825406_1076825424 26 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825406_1076825427 30 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825427 10:132964863-132964885 CTGTGGCCAGGCCTGGCGGGCGG No data
1076825406_1076825426 27 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825426 10:132964860-132964882 CCACTGTGGCCAGGCCTGGCGGG No data
1076825406_1076825416 13 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825406_1076825418 18 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825418 10:132964851-132964873 TCCCTCCTCCCACTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825406 Original CRISPR GGGCGTCCTGGGGGTGACCT GGG (reversed) Intergenic
No off target data available for this crispr