ID: 1076825408

View in Genome Browser
Species Human (GRCh38)
Location 10:132964815-132964837
Sequence GTCACCCCCAGGACGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825402_1076825408 -3 Left 1076825402 10:132964795-132964817 CCTGCCCTCTGTGAGCCCAGGTC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825399_1076825408 4 Left 1076825399 10:132964788-132964810 CCTAGGCCCTGCCCTCTGTGAGC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825404_1076825408 -8 Left 1076825404 10:132964800-132964822 CCTCTGTGAGCCCAGGTCACCCC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825403_1076825408 -7 Left 1076825403 10:132964799-132964821 CCCTCTGTGAGCCCAGGTCACCC No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825398_1076825408 5 Left 1076825398 10:132964787-132964809 CCCTAGGCCCTGCCCTCTGTGAG No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data
1076825401_1076825408 -2 Left 1076825401 10:132964794-132964816 CCCTGCCCTCTGTGAGCCCAGGT No data
Right 1076825408 10:132964815-132964837 GTCACCCCCAGGACGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825408 Original CRISPR GTCACCCCCAGGACGCCCAG CGG Intergenic
No off target data available for this crispr