ID: 1076825409

View in Genome Browser
Species Human (GRCh38)
Location 10:132964819-132964841
Sequence GCAGCCGCTGGGCGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825409_1076825418 9 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825418 10:132964851-132964873 TCCCTCCTCCCACTGTGGCCAGG No data
1076825409_1076825424 17 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825409_1076825428 22 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825428 10:132964864-132964886 TGTGGCCAGGCCTGGCGGGCGGG No data
1076825409_1076825427 21 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825427 10:132964863-132964885 CTGTGGCCAGGCCTGGCGGGCGG No data
1076825409_1076825426 18 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825426 10:132964860-132964882 CCACTGTGGCCAGGCCTGGCGGG No data
1076825409_1076825422 14 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825409_1076825416 4 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825409 Original CRISPR GCAGCCGCTGGGCGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr