ID: 1076825415

View in Genome Browser
Species Human (GRCh38)
Location 10:132964846-132964868
Sequence CCACAGTGGGAGGAGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825415_1076825426 -9 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825426 10:132964860-132964882 CCACTGTGGCCAGGCCTGGCGGG No data
1076825415_1076825432 25 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825432 10:132964894-132964916 TCCCGACACGCACACTTTGCCGG No data
1076825415_1076825436 27 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825436 10:132964896-132964918 CCGACACGCACACTTTGCCGGGG No data
1076825415_1076825434 26 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825434 10:132964895-132964917 CCCGACACGCACACTTTGCCGGG No data
1076825415_1076825424 -10 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825415_1076825428 -5 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825428 10:132964864-132964886 TGTGGCCAGGCCTGGCGGGCGGG No data
1076825415_1076825427 -6 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825427 10:132964863-132964885 CTGTGGCCAGGCCTGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825415 Original CRISPR CCACAGTGGGAGGAGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr