ID: 1076825416

View in Genome Browser
Species Human (GRCh38)
Location 10:132964846-132964868
Sequence CCACCTCCCTCCTCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825411_1076825416 2 Left 1076825411 10:132964821-132964843 CCCAGGACGCCCAGCGGCTGCTG No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825401_1076825416 29 Left 1076825401 10:132964794-132964816 CCCTGCCCTCTGTGAGCCCAGGT No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825410_1076825416 3 Left 1076825410 10:132964820-132964842 CCCCAGGACGCCCAGCGGCTGCT No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825406_1076825416 13 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825403_1076825416 24 Left 1076825403 10:132964799-132964821 CCCTCTGTGAGCCCAGGTCACCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825407_1076825416 12 Left 1076825407 10:132964811-132964833 CCAGGTCACCCCCAGGACGCCCA No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825413_1076825416 -7 Left 1076825413 10:132964830-132964852 CCCAGCGGCTGCTGCGCCACCTC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825402_1076825416 28 Left 1076825402 10:132964795-132964817 CCTGCCCTCTGTGAGCCCAGGTC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825412_1076825416 1 Left 1076825412 10:132964822-132964844 CCAGGACGCCCAGCGGCTGCTGC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825414_1076825416 -8 Left 1076825414 10:132964831-132964853 CCAGCGGCTGCTGCGCCACCTCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825404_1076825416 23 Left 1076825404 10:132964800-132964822 CCTCTGTGAGCCCAGGTCACCCC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
1076825409_1076825416 4 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825416 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825416 Original CRISPR CCACCTCCCTCCTCCCACTG TGG Intergenic
No off target data available for this crispr