ID: 1076825422

View in Genome Browser
Species Human (GRCh38)
Location 10:132964856-132964878
Sequence CCTCCCACTGTGGCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825411_1076825422 12 Left 1076825411 10:132964821-132964843 CCCAGGACGCCCAGCGGCTGCTG No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825409_1076825422 14 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825413_1076825422 3 Left 1076825413 10:132964830-132964852 CCCAGCGGCTGCTGCGCCACCTC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825412_1076825422 11 Left 1076825412 10:132964822-132964844 CCAGGACGCCCAGCGGCTGCTGC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825407_1076825422 22 Left 1076825407 10:132964811-132964833 CCAGGTCACCCCCAGGACGCCCA No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825406_1076825422 23 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825410_1076825422 13 Left 1076825410 10:132964820-132964842 CCCCAGGACGCCCAGCGGCTGCT No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data
1076825414_1076825422 2 Left 1076825414 10:132964831-132964853 CCAGCGGCTGCTGCGCCACCTCC No data
Right 1076825422 10:132964856-132964878 CCTCCCACTGTGGCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825422 Original CRISPR CCTCCCACTGTGGCCAGGCC TGG Intergenic
No off target data available for this crispr