ID: 1076825424

View in Genome Browser
Species Human (GRCh38)
Location 10:132964859-132964881
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076825414_1076825424 5 Left 1076825414 10:132964831-132964853 CCAGCGGCTGCTGCGCCACCTCC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825413_1076825424 6 Left 1076825413 10:132964830-132964852 CCCAGCGGCTGCTGCGCCACCTC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825409_1076825424 17 Left 1076825409 10:132964819-132964841 CCCCCAGGACGCCCAGCGGCTGC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825406_1076825424 26 Left 1076825406 10:132964810-132964832 CCCAGGTCACCCCCAGGACGCCC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825412_1076825424 14 Left 1076825412 10:132964822-132964844 CCAGGACGCCCAGCGGCTGCTGC No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825411_1076825424 15 Left 1076825411 10:132964821-132964843 CCCAGGACGCCCAGCGGCTGCTG No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825410_1076825424 16 Left 1076825410 10:132964820-132964842 CCCCAGGACGCCCAGCGGCTGCT No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825407_1076825424 25 Left 1076825407 10:132964811-132964833 CCAGGTCACCCCCAGGACGCCCA No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data
1076825415_1076825424 -10 Left 1076825415 10:132964846-132964868 CCACCTCCCTCCTCCCACTGTGG No data
Right 1076825424 10:132964859-132964881 CCCACTGTGGCCAGGCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076825424 Original CRISPR CCCACTGTGGCCAGGCCTGG CGG Intergenic