ID: 1076827295

View in Genome Browser
Species Human (GRCh38)
Location 10:132975454-132975476
Sequence CTGAGGATAAGGAGGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 452}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827295_1076827309 20 Left 1076827295 10:132975454-132975476 CCTTACCCCCTCCTTATCCTCAG 0: 1
1: 0
2: 0
3: 33
4: 452
Right 1076827309 10:132975497-132975519 CTCCATGCTCTGCCCTGGTTGGG 0: 1
1: 0
2: 1
3: 40
4: 251
1076827295_1076827305 15 Left 1076827295 10:132975454-132975476 CCTTACCCCCTCCTTATCCTCAG 0: 1
1: 0
2: 0
3: 33
4: 452
Right 1076827305 10:132975492-132975514 CCCTCCTCCATGCTCTGCCCTGG 0: 1
1: 0
2: 7
3: 49
4: 590
1076827295_1076827308 19 Left 1076827295 10:132975454-132975476 CCTTACCCCCTCCTTATCCTCAG 0: 1
1: 0
2: 0
3: 33
4: 452
Right 1076827308 10:132975496-132975518 CCTCCATGCTCTGCCCTGGTTGG 0: 1
1: 0
2: 2
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827295 Original CRISPR CTGAGGATAAGGAGGGGGTA AGG (reversed) Intergenic
900192785 1:1358566-1358588 CTAAGGAGGGGGAGGGGGTAGGG - Intronic
901645482 1:10714851-10714873 CTGAGGAGAGGGTGGGGGTTGGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902323158 1:15683064-15683086 ATAAGGATAAGGAGTGGGAATGG + Intergenic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903170322 1:21548327-21548349 CTCAGGACAAGGAGAGGGTGGGG - Intronic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903999442 1:27330695-27330717 GTGAGGAAAAGGACGGGGAAGGG - Intronic
904019236 1:27449672-27449694 ATAAGGATAAGGAGGGTGTCTGG + Intronic
904464044 1:30697649-30697671 CTGAGGTTAGGGTGGGGGTTGGG - Intergenic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
904962459 1:34345036-34345058 CTGAGTATAAGGAAGAGGTTAGG - Intergenic
905352088 1:37354879-37354901 CTGAGAATATGGTGGGGGTGGGG + Intergenic
905584577 1:39106265-39106287 CCGGGGAGATGGAGGGGGTAAGG - Intronic
905794592 1:40808499-40808521 CTGAAGAGATGGAGGAGGTATGG - Intronic
905935282 1:41818541-41818563 GTGAGGATAAGAAGAGGTTATGG + Intronic
906139372 1:43524636-43524658 CTGAGAAGCAGGAGTGGGTAGGG + Intergenic
906460801 1:46034148-46034170 CTGATGACAAGGAGCGGTTAAGG - Exonic
906691994 1:47798784-47798806 CTGAGGATACGGAGGCTGTGGGG - Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907030468 1:51166161-51166183 CTGAGGGTGTGGAGGGGGTGGGG - Intergenic
907222157 1:52914973-52914995 TTGAGGAAAAGAAGGGGGAAGGG - Intronic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
909853259 1:80496119-80496141 CTGATGCTAAGATGGGGGTAGGG - Intergenic
912390136 1:109297257-109297279 CTGAGGAGAAAAAGGGGCTAGGG - Intronic
913969151 1:143401308-143401330 CTGATGCTAAGGCTGGGGTAGGG - Intergenic
914063528 1:144226907-144226929 CTGATGCTAAGGCTGGGGTAGGG - Intergenic
914115622 1:144739447-144739469 CTGATGCTAAGGCTGGGGTAGGG + Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915314368 1:155019628-155019650 CTGGGGAAGAGGAGGGGCTAAGG - Intronic
915994578 1:160550138-160550160 CTTAGGATCAGGAAGGGATAAGG + Intronic
916389946 1:164320674-164320696 GGGAGGTAAAGGAGGGGGTAAGG + Intergenic
916506958 1:165436749-165436771 TTGAGGAAATGGAGGGGGTCAGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917581837 1:176386708-176386730 CTGGGGTTGAGGTGGGGGTAGGG + Intergenic
917723793 1:177811311-177811333 ATGAGGATAAGGTGGAGATAAGG + Intergenic
918059832 1:181051471-181051493 CCGATGATAAGGTGGGGGTCAGG + Intronic
918136740 1:181680672-181680694 CTGAGGACAGGGATGGGGTGTGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918743216 1:188163600-188163622 CTCAGGACAAGGATGGAGTATGG - Intergenic
919796229 1:201322990-201323012 CTGAGGATAAAGAGCCGGTCAGG - Intronic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920344381 1:205296631-205296653 CTAATAATAAGGATGGGGTATGG - Intergenic
920737866 1:208551444-208551466 CTGCTGATAAGGATGGGGAAGGG - Intergenic
921062571 1:211598071-211598093 CTGAGGATAACTAGGTGGTTGGG + Intergenic
922107783 1:222527328-222527350 CTGAGGGCAAGGAGGTGATAAGG - Intronic
922171926 1:223162623-223162645 CTGATGACAAGGTGGGGGCATGG - Intergenic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922686155 1:227640112-227640134 CTGAGGATGTGAAGGGGGAAAGG + Intronic
924432615 1:244009675-244009697 CTGATCATCAGGAGGAGGTAGGG + Intergenic
1063903540 10:10760278-10760300 CTCAGGATAAAGAGGGGGACTGG - Intergenic
1063939010 10:11108022-11108044 GTGAGGAGAGGGAGGGAGTAAGG - Intronic
1064603998 10:17019372-17019394 ATGGGGAAAAGGAAGGGGTAGGG - Intronic
1065966988 10:30778731-30778753 AGAAGGATAAGGAGGGGGGAAGG + Intergenic
1066648817 10:37636762-37636784 CAGATGAAAAGGAGGGGGAAGGG + Intergenic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067031711 10:42882465-42882487 CAGATGAAAAGGAGGGGGAAGGG + Intergenic
1067163313 10:43845245-43845267 CAGAGAATCATGAGGGGGTAGGG + Intergenic
1067455190 10:46414219-46414241 CTGAGGGTAAGGGGTGGGTGAGG - Intergenic
1067542899 10:47169043-47169065 TTGAGGAGAAGGAAGGGGAAGGG - Intergenic
1067632010 10:47970415-47970437 CTGAGGGTAAGGGGTGGGTGAGG + Intergenic
1067665240 10:48271958-48271980 CTGAGTATATGGAGAGGGCAGGG + Intronic
1069164492 10:65135237-65135259 GTGGGGATATGGAGGTGGTATGG + Intergenic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1069880039 10:71586597-71586619 GTGAGGGTAAGGTGTGGGTAAGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071371094 10:84952488-84952510 CTCAGGATAGAGAGGGGGAATGG + Intergenic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072935453 10:99708160-99708182 CTTAGGATGAGGAGGGGGTGGGG - Intronic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1074362910 10:112837418-112837440 CTGAGGAAAAGCAGGGGTCATGG - Intergenic
1074391216 10:113059466-113059488 CTGGGGAAAAGGCGGGGGTTGGG + Intronic
1074408400 10:113201336-113201358 CTGGGGTTCAGGATGGGGTAGGG - Intergenic
1074781259 10:116804009-116804031 GTGGGGATGAGGAGGGGCTAAGG - Intergenic
1075677872 10:124308736-124308758 GTGTGTATATGGAGGGGGTAGGG - Intergenic
1076252502 10:128995516-128995538 CTGAGGTAAACCAGGGGGTAGGG - Intergenic
1076675125 10:132143730-132143752 CTCAGGATAAGGAAGGGGGCAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077266788 11:1654882-1654904 CTGAGGCTGGGCAGGGGGTAGGG + Intergenic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1077938163 11:6812716-6812738 CCCAGGATAAGGAGGTGGTGAGG - Intergenic
1078425998 11:11251951-11251973 CTGAGGCTAAAGAGGGTGTCTGG + Intergenic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1082001939 11:47398050-47398072 CTGAGAATAGGGACAGGGTAGGG - Intergenic
1083941162 11:65896705-65896727 CACAGGCTTAGGAGGGGGTAAGG - Intronic
1083975829 11:66119101-66119123 CAGAGGACAAGCAGGGAGTAGGG - Intronic
1084014826 11:66371970-66371992 CGGAGGGGAAGGCGGGGGTAGGG + Intronic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084506418 11:69571131-69571153 CTGAGGATCAGGAGGGGTCTGGG - Intergenic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085193802 11:74653384-74653406 CAAAGGATGAGGAGGGAGTATGG + Intronic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085304318 11:75476609-75476631 CTGAGGCAAAGGAGAGGGAAGGG - Intronic
1085310039 11:75510752-75510774 CGGAGGAGGAGGAGGGGGGAGGG - Intronic
1085677731 11:78540563-78540585 CTGGGTAAAAGGTGGGGGTAGGG - Intronic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088590392 11:111397980-111398002 CAGAGGATAAGGTTGTGGTAGGG - Intronic
1089417125 11:118301581-118301603 CTGATGATAAGGAGGAGGCAGGG + Intergenic
1089419477 11:118320356-118320378 GTAAGGCTAAGTAGGGGGTATGG - Intergenic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1090663239 11:128896443-128896465 CAGAGGTTAAGGAGAGGGTGGGG - Intronic
1090678877 11:129031790-129031812 CACAGGATAAGGAGCGGGTCAGG - Intronic
1090992696 11:131834021-131834043 ATGAGGATGAGGTGGAGGTAGGG + Intronic
1091354423 11:134924702-134924724 CTGGGGAAAATGAGGGGGTCAGG - Intergenic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1092226677 12:6752724-6752746 CTGAGTGTAAGGAGGGGGCGGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092802742 12:12186833-12186855 GTGAGGATCAGGAGGAGGGAGGG - Intronic
1094372123 12:29750172-29750194 GTGAGGGCAAGGAGGGGGCAGGG - Intronic
1096584518 12:52611121-52611143 CTCAAGAGAAGGAGGGGGCAGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097381974 12:58906107-58906129 CAGAGTATAAGGATGGGATATGG + Intronic
1098572231 12:72001280-72001302 CTAAGGGTAATGAGGGAGTAAGG + Intronic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1100662695 12:96717320-96717342 CTGAGGATGAGGGAGGGCTAGGG - Intronic
1100951121 12:99851371-99851393 ATGATGATCAGGTGGGGGTAGGG - Intronic
1101252801 12:102951787-102951809 ATGAGAAGAAGGAGGGGGAAGGG - Intronic
1101352954 12:103949693-103949715 CTTAAGGTAGGGAGGGGGTAGGG - Intronic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1102067963 12:109994910-109994932 TTGAAGATAGGGAGGGGGTATGG - Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102812778 12:115838754-115838776 CTGAGGATGAGGACGAGGCATGG + Intergenic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103572898 12:121856807-121856829 CTGAGGATCCAGAGGGGGTCTGG - Intronic
1104350254 12:128039104-128039126 CCCAGGATCAGGAGGAGGTAGGG - Intergenic
1104468603 12:129009951-129009973 CTGGGGCAGAGGAGGGGGTAAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1106713452 13:32362892-32362914 AAGAGGTTAAGGAGGGGGTGGGG - Intronic
1107142898 13:37022247-37022269 CTGAGCATCAGGAGGGTGTGGGG + Exonic
1107250694 13:38357847-38357869 CTGAGGAGAAGGAAGAGGAAGGG + Intronic
1108282836 13:48876461-48876483 GTGAGGGTAGGGAGGGGGTAGGG - Intergenic
1109158975 13:58948617-58948639 CTAAGGATGAGGATAGGGTAGGG + Intergenic
1111615563 13:90658369-90658391 ATGAAGAAAAGCAGGGGGTAGGG + Intergenic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1114057246 14:18982153-18982175 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1114105300 14:19419593-19419615 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1114533924 14:23411532-23411554 CAGAGGAGAAAAAGGGGGTAGGG - Intergenic
1115066183 14:29263670-29263692 CTGATGATAAGGATGGCATAAGG - Intergenic
1115512056 14:34147398-34147420 CTCCGGATAAGGAGGAGGGAAGG + Intronic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1117460595 14:55940953-55940975 GTTAGGTTAAGGAGGGGGTCTGG - Intergenic
1118338607 14:64876718-64876740 CTGAGGATAAGCAGGAGAGAAGG - Intronic
1118357792 14:65029611-65029633 GTGAGGATAAGGTGGAGGCAGGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119464978 14:74849977-74849999 CTGAGGATAAAGTGGGGAAAGGG + Intronic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1120899917 14:89566891-89566913 GAGGGGAGAAGGAGGGGGTAGGG - Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1122050986 14:99059658-99059680 CTGGGGATAAGGAGGGGAATAGG - Intergenic
1122489914 14:102107661-102107683 CAGAGGATATGTAGGGGATATGG + Intronic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123498187 15:20851931-20851953 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123555418 15:21425559-21425581 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1123591661 15:21862890-21862912 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1125187600 15:36949724-36949746 CTGAGGAAAAGGAGGGGCAGAGG - Intronic
1125906772 15:43400236-43400258 ATGAGTAGAAGGAAGGGGTACGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1127752671 15:62060833-62060855 CTGTGGATCAGGTGGGGGAAAGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128051867 15:64671905-64671927 CTGAGAATAAGAAAGTGGTATGG - Intronic
1128257562 15:66209744-66209766 CTGGGGTTTAGGAAGGGGTAAGG + Intronic
1128533303 15:68470073-68470095 CTAAGGATACGGTGGGGGTAAGG + Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128589325 15:68880740-68880762 CTGATGAGAAGGAGGGGGGCAGG + Intronic
1128721143 15:69949327-69949349 ATGAGGAAAAGGAGGAGGTGCGG - Intergenic
1128747351 15:70123873-70123895 CTAAGGATAAGGAGGGGCAAAGG - Intergenic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1130219809 15:82009948-82009970 CTGAGGATAAAAAGAGGATAGGG - Intergenic
1131070065 15:89460626-89460648 CTGAGATGAAGGATGGGGTAGGG - Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1132121529 15:99180119-99180141 CTGAGGAGAAGGAGTGAGTGTGG - Intronic
1202963762 15_KI270727v1_random:152769-152791 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1135136042 16:19885763-19885785 CTGAGGACTAGGACGGGGTGAGG - Intronic
1135191805 16:20360562-20360584 TTGAGGATGAGGATGAGGTAAGG - Exonic
1135325098 16:21520823-21520845 CTGAGGCCAAGGATGGGGTTTGG + Intergenic
1135516492 16:23139995-23140017 GTGAGGAAAAGGAGGAGGAAAGG - Intronic
1136174166 16:28506146-28506168 CAGAGGGTAAGGAGGGGGTCTGG - Intronic
1136174383 16:28507137-28507159 CCGAGAATCAGGAGGGGGTTTGG - Intronic
1136336581 16:29614091-29614113 CTGAGGCCAAGGATGGGGTTTGG + Intergenic
1137735171 16:50718538-50718560 CTGCGGATAAGCAGGGGGCAGGG + Intronic
1138344004 16:56308912-56308934 CTGATGAAAAGGTGGGGGTGGGG - Intronic
1138624542 16:58238708-58238730 CTTGGGATATGGAGGGGGCAGGG - Intronic
1139252008 16:65505581-65505603 CTGGGGATAAAGAGGGTGTGAGG + Intergenic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140495104 16:75379589-75379611 CAGAGGTTAAGGAGGGGGTGAGG + Intronic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141848824 16:86630217-86630239 CAGAGGCTAAGGAGGAGGCAGGG + Intergenic
1142575444 17:903967-903989 CTGTGGACAAGGAGGAGTTAAGG + Intronic
1142656632 17:1399267-1399289 CTGAGGAAAGGGAGGGAGTGAGG + Intronic
1145113771 17:20189185-20189207 CTGAGAATAAGGAGGAGCTGAGG - Intronic
1146507535 17:33418267-33418289 CTGAAGATTAGGATGGGGTTTGG - Intronic
1146913235 17:36661321-36661343 CTGATGATGGGGAGGGGGCAGGG + Intergenic
1147250000 17:39147549-39147571 CAGAGGAAAGGGAGAGGGTATGG - Intronic
1147992490 17:44343687-44343709 CTGAGGATGAGGCAGGGGCAGGG - Intergenic
1148703762 17:49609697-49609719 CTGAGGATAAGTGGGAGGAAAGG + Intronic
1149401799 17:56304161-56304183 CAGGAGTTAAGGAGGGGGTAGGG - Intronic
1149439530 17:56663036-56663058 CTGAGGATACGGAAGAGGCAGGG + Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1152648159 17:81479806-81479828 CTGAAGAAAAGCAGGGGGCAAGG - Intergenic
1152923082 17:83075428-83075450 ATTAGGTTAAGGAGGGGGTTAGG + Intergenic
1152993379 18:383663-383685 GTGTGGAGAAGGAGTGGGTAGGG - Intronic
1154041613 18:10861222-10861244 TTGAGGCTAAGGAGGAGGAAAGG + Intronic
1154456189 18:14528356-14528378 CTGAGGCTGAGGAGGGGGATTGG - Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155588407 18:27395870-27395892 CTGAGCATAAAGAGGAGGAATGG - Intergenic
1157625309 18:49045787-49045809 TGGAGGCTAAGGAGGGGGTGGGG + Intronic
1158165120 18:54531569-54531591 TTGAGGAAAAGGGGTGGGTAGGG + Intergenic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1159522808 18:69547708-69547730 CAGAGGCTAAGAAGGGTGTATGG - Intronic
1162520326 19:11175821-11175843 CTGAGGATGAGGAGAGGCCACGG + Intronic
1163023291 19:14495298-14495320 CTGATGATGAGTACGGGGTAGGG + Intronic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163174253 19:15552912-15552934 CTGAGGGGAGGGAGGTGGTAAGG + Intergenic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1166357586 19:42236285-42236307 CTCAGGATAAGGGGGTGGTGGGG - Intronic
1166568935 19:43781094-43781116 TTGAGAATAAGGAGGGGCTAGGG + Exonic
1166721939 19:45001847-45001869 CAGAGGGTGATGAGGGGGTACGG + Intronic
1166722062 19:45002242-45002264 CAGAGAATGAGGAGGGGGTGGGG + Intronic
1167177304 19:47873980-47874002 ATGAGGACAAGGACGGGGTTGGG - Intronic
1167336709 19:48890805-48890827 CTAAGGACAGGGAGGGGTTAGGG + Intronic
1167487772 19:49773144-49773166 CTGCAGATAAGGAGGGGGAGAGG + Intronic
1167504435 19:49863648-49863670 GTGAGGAAAAGGAGGGGGGCCGG + Intronic
1167804844 19:51773817-51773839 CAGGGGATAGGGAGGAGGTAGGG - Intronic
1168233005 19:55045149-55045171 CTGAGGATGAGGAGGTGGCCCGG - Exonic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
927393879 2:22627245-22627267 GGGAGGATGAGGAGGTGGTAGGG - Intergenic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
930002892 2:46873184-46873206 CTGAGGATGAGAAGGAGGAATGG - Intergenic
930171305 2:48254484-48254506 CTGAGAATAAGGAGGGGGAGAGG + Intergenic
930200035 2:48543946-48543968 TTGAGGAGTAGGTGGGGGTAGGG + Intronic
931183476 2:59927055-59927077 GTGAGAAGCAGGAGGGGGTAGGG + Intergenic
931381494 2:61757708-61757730 CAGGGGTTAAGGAGGGGGTGGGG - Intergenic
932438366 2:71716504-71716526 TTCAGGGGAAGGAGGGGGTATGG + Intergenic
934173845 2:89562212-89562234 CTGATGCTAAGGCTGGGGTAGGG - Intergenic
934284159 2:91636561-91636583 CTGATGCTAAGGCTGGGGTAGGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937085659 2:119170210-119170232 ATGAAGATGAGGAGGGGGTGAGG + Intergenic
937971255 2:127551070-127551092 CTGAGGATGGGGTGGGGGTGGGG + Intronic
938283902 2:130091313-130091335 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938285053 2:130105878-130105900 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938334547 2:130479877-130479899 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938335696 2:130494427-130494449 CTGAGGCTGAGGAGGGGGATTGG - Intronic
938354125 2:130626237-130626259 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938355279 2:130640793-130640815 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938430552 2:131233014-131233036 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938431705 2:131247580-131247602 CTGAGGCTGAGGAGGGGGATTGG + Intronic
938475377 2:131606184-131606206 CTGAGGCTGAGGAGGGGGATTGG + Intergenic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
943806217 2:192130280-192130302 CAGAGGAGAAGGAGGAGGAAGGG - Intronic
944301620 2:198130613-198130635 CTGAGGATAAGCAGGACATATGG - Intronic
945649489 2:212539734-212539756 CTGAGGATTAGGTAGTGGTAGGG + Intergenic
946308435 2:218869559-218869581 CAGAGGACAGGGTGGGGGTAGGG - Intronic
946312714 2:218891867-218891889 CTGAGGGAAAGGAGGGGATGTGG + Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
947796599 2:232897109-232897131 GTGAGGGTAGGGATGGGGTAGGG + Intronic
948082529 2:235218477-235218499 CTGAGGATTGGGAGGCAGTATGG + Intergenic
949027146 2:241771714-241771736 CTGAGGCCAAGGAGGGGGCCAGG + Intergenic
1169279937 20:4258298-4258320 ATGAGGCTATGGAAGGGGTATGG - Intergenic
1170957568 20:20995349-20995371 CAGAAGAGAAGGAGGGGGTATGG + Intergenic
1171043228 20:21786235-21786257 CTGAGGACAAGGAGAGGCAAAGG + Intergenic
1171486389 20:25489456-25489478 GTAAGGAGAAGGAGGGGGGATGG - Intronic
1171951105 20:31423285-31423307 CTGAGAAGAAGAAGGGGGTGAGG + Intergenic
1172038260 20:32025692-32025714 TTGAGGATCAGGAGAGGGGAGGG + Intronic
1172565058 20:35923580-35923602 TTGGGGATAAGGTGGGGATAAGG - Intronic
1172761922 20:37328984-37329006 CTGAGGACAAGGCAGGGGTCAGG - Intergenic
1173190003 20:40868917-40868939 CTGAGGCTATCAAGGGGGTATGG + Intergenic
1173241843 20:41303830-41303852 GTGAGGATAAGAGGGGGCTATGG - Intronic
1173436295 20:43034910-43034932 CTGAGGAAAAGGTGGGGGTGGGG - Intronic
1174137545 20:48391009-48391031 AGGAAGAGAAGGAGGGGGTAGGG + Intergenic
1174187426 20:48716559-48716581 CAGAGGAAGAGGAGGTGGTAAGG + Intronic
1174595300 20:51678891-51678913 CTGAGGATGAGGCTGGGGTTTGG - Intronic
1174729005 20:52896153-52896175 CTAAGGACAGGGAGGGGGTTGGG - Intergenic
1175238184 20:57526868-57526890 GGGAGGATAAGGAGGGGCAATGG + Intergenic
1175926019 20:62472045-62472067 CTGAGGTTAAGAAGGGGTTAGGG - Intronic
1176104215 20:63378065-63378087 CTGAGGATAATGGGGGCGTGGGG + Intronic
1176817975 21:13624980-13625002 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1176935892 21:14866489-14866511 CAGAGGTTAAGAAGGGGGCAAGG + Intergenic
1177197421 21:17918087-17918109 CTGAGGATAAGGAAGGTGTTAGG + Intronic
1179103511 21:38377682-38377704 TTGAGGCTAAGGAAGGGGTGGGG - Intergenic
1180475736 22:15704765-15704787 CTGAGGCTGAGGAGGGGGATTGG + Intronic
1181458366 22:23071894-23071916 CTGGGGAGTAGGAGGAGGTATGG + Intronic
1181919249 22:26307314-26307336 CTGAGGGGTAGGAGAGGGTAGGG + Intronic
1182114688 22:27749320-27749342 CTGAGGACCTGGAGGGGGTGGGG + Exonic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182776938 22:32838245-32838267 TTGAGGAGAAGGAGGGGGGGTGG + Intronic
1183686147 22:39362448-39362470 CTGGGGAAAAGGTGGGGGTGGGG - Intronic
1184748977 22:46473373-46473395 CTGAGGACATGGAGGAGGAAAGG + Intronic
949382811 3:3464969-3464991 CTGAGAATTAGGAGGGGAAAAGG + Intergenic
949634723 3:5970074-5970096 CTAAGGATAAGGGAGGAGTAAGG + Intergenic
949895250 3:8763500-8763522 ATGAGGATGAGGAGGGAGTTTGG - Intronic
950912305 3:16606744-16606766 CTTAGGAAAAGGATGGAGTAGGG + Intronic
951005392 3:17609896-17609918 CTGAGTATAAGTTGGTGGTATGG - Intronic
951143281 3:19194632-19194654 GGAAAGATAAGGAGGGGGTAGGG + Intronic
953020335 3:39108978-39109000 CTGAGGAGGAGCAGGGGATAGGG + Intronic
954555090 3:51511290-51511312 CTGAGGTTAGGAAGTGGGTAGGG + Intergenic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956391903 3:68782733-68782755 CTAAGGAGAGGGAGGGGGAATGG + Intronic
957096497 3:75781655-75781677 TTGAGGAAAGGGAGTGGGTAAGG - Intronic
958511493 3:95055217-95055239 GGAAGGATTAGGAGGGGGTATGG + Intergenic
959537759 3:107506154-107506176 CTGAGGAGAAGAAGAGGATAGGG - Intergenic
961127412 3:124432555-124432577 TTGAAGATAAAGAGGAGGTATGG - Intronic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
961406333 3:126682287-126682309 CTGAGGCCCAGGAAGGGGTATGG - Intergenic
962760093 3:138503698-138503720 CTGAGGAGGAGGAGGAGGCAAGG - Intronic
962958730 3:140290513-140290535 ATGAGGAAAAGGAGGAGGTAGGG + Intronic
964262780 3:154858514-154858536 CTCAGGATAGGGAGTGGGGATGG - Intergenic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
969038064 4:4272058-4272080 CAGAGGCTAAGGAGGGGGTGGGG + Intronic
969643185 4:8411413-8411435 CTGAGGAGAAGTAGGAGGTGGGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970978442 4:22069478-22069500 CTCAGGATAATGAGGGGGTCTGG + Intergenic
971391881 4:26193782-26193804 CTGAGCATAAGAGGGGGCTATGG - Intronic
971671757 4:29567452-29567474 TTGATGATAAGGAGGAGGAAGGG + Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
973656511 4:53053706-53053728 CTGAGGAACAGGAGGGTGTTGGG - Intronic
974925279 4:68291181-68291203 CTGAGGATGATGAGGAGGAAGGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975915435 4:79319723-79319745 ATGAAGATAAAGAGGGGGTTGGG - Intronic
976460235 4:85302533-85302555 CTGCTGGTAAGGAGGGTGTAGGG + Intergenic
977825568 4:101527354-101527376 GTGTGGCAAAGGAGGGGGTAGGG + Intronic
978834143 4:113127576-113127598 TTGAGGATAGGTAGGTGGTAGGG + Intronic
979142687 4:117197961-117197983 CTGAGGATAAAGAGAGGTTCTGG - Intergenic
979992285 4:127389436-127389458 ATGAGTAAAAGGAAGGGGTAGGG + Intergenic
980461456 4:133120355-133120377 CTGAGGTTATGGATGGGCTAGGG - Intergenic
980837781 4:138218085-138218107 TAGAGGATAATTAGGGGGTATGG - Intronic
981404606 4:144353672-144353694 CTCAGAATAAGAAGGAGGTAGGG - Intergenic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
981947653 4:150367291-150367313 CAGAGAATAAGGTGGAGGTAAGG + Intronic
982907859 4:161099871-161099893 CTGAGCCTGAGGAGGTGGTAAGG - Intergenic
983324020 4:166229657-166229679 ATGAGGCTGAGGAAGGGGTAGGG - Intergenic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
987092697 5:14522072-14522094 CGAAGGATAAGGAGGCGGTTGGG - Intronic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
990269167 5:54116152-54116174 CTGGGGAGCAGGAGGGGGTTGGG + Intronic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
990637343 5:57743648-57743670 CTGGTGGTAAGTAGGGGGTAAGG + Intergenic
990647527 5:57861150-57861172 CTGAGGCTAAGGTGGAGGTGGGG + Intergenic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
993630404 5:90279409-90279431 CTGATGATAGGGAGGTGATAGGG - Intergenic
994307626 5:98226105-98226127 CTGAGGATGAGGGGAGAGTAGGG + Intergenic
995859818 5:116629422-116629444 CTGATGATCAGGAGGAGGTGGGG + Intergenic
996185183 5:120465209-120465231 TTGGGGCTAAGGAGGGGGTCTGG + Intronic
996396182 5:123016432-123016454 TGGAGGATAATGAGGGGCTACGG + Intronic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997028820 5:130098215-130098237 CAGAGATTAAGGAGGGGGTAAGG - Intronic
997982621 5:138478379-138478401 CTGAGGATTTGGAGGGGCTCTGG + Intergenic
999827397 5:155287145-155287167 CTGAAGAGATGGAAGGGGTAAGG + Intergenic
1000121238 5:158199585-158199607 CTGAGGAGAAGGAGGAGGAGTGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000148397 5:158475685-158475707 GTGAGGATAATGTGGGGGCAGGG + Intergenic
1000443000 5:161285193-161285215 CTAAGGATTACGAAGGGGTAAGG - Intergenic
1002194670 5:177495453-177495475 CTGGGGGTCAGGAGGGGGTGGGG - Intronic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003004312 6:2366970-2366992 CTGTGGAAAAGCAGGGGGCAGGG - Intergenic
1004590177 6:17043039-17043061 CAGAAGATAAGGAAGGGGTGGGG - Intergenic
1004762454 6:18683271-18683293 CTGAGCATGAGGAGGTGGAATGG - Intergenic
1006012872 6:31056960-31056982 CTGAGGATAAGCGGTGGGCATGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006686012 6:35834881-35834903 ATAAGGATGAGGAGGGGGAAAGG - Exonic
1006741354 6:36311304-36311326 CTGAGGATAAGGGTGTGGGAGGG + Intergenic
1007408366 6:41647601-41647623 CTGAGGACAAGGTGGGGGATCGG - Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1009855962 6:69264082-69264104 ATGAGGATAAGGAGTGAATAAGG - Intronic
1011132617 6:84067026-84067048 GTGACGAGAAGGAGGGGGTGAGG - Intronic
1012399770 6:98834120-98834142 ATGGGGAAACGGAGGGGGTAAGG - Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1013172606 6:107650293-107650315 CTCATGGTAAGGAGAGGGTATGG - Intronic
1014159717 6:118154002-118154024 CTGAGGATGAGGTGGGAATATGG + Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016426320 6:143939467-143939489 CTGAGAACAAAGAGGGGATATGG + Intergenic
1017374434 6:153751660-153751682 CAGAGGAAAGGGTGGGGGTAGGG - Intergenic
1017742516 6:157419455-157419477 CAGAGGATGGGGAGGGTGTATGG - Intronic
1017805536 6:157942499-157942521 CTGAGGAAAAGCAGGTGGTCTGG + Intronic
1018403748 6:163454650-163454672 TTGAGAAAAAGGAAGGGGTAAGG - Intronic
1018429728 6:163713482-163713504 GAGAGGAGAAGGTGGGGGTAGGG - Intergenic
1018817673 6:167347280-167347302 CAGAGGCTGAGGAGTGGGTAGGG + Intronic
1019501343 7:1366358-1366380 CTGAGGACAGGTAGGGGGTTGGG + Intergenic
1019764938 7:2843540-2843562 GGGAGGCTAAGGAGGGAGTAGGG + Intronic
1020403916 7:7809697-7809719 CTGAGGGAAGGGAGTGGGTAGGG - Intronic
1021475911 7:21060250-21060272 ATGAGGATAAGGAGGCTTTAGGG + Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022796039 7:33732023-33732045 GTGAGGCTCAGGAGGGTGTAAGG - Intergenic
1023481741 7:40642433-40642455 CTGAGGGTAAGGAGAAGGAAGGG + Intronic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1024613267 7:51085179-51085201 CTGAGGATAAGGAGGAGAACAGG - Exonic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1027025681 7:74850557-74850579 CTGGGGATAGGGACGGGGTGGGG + Intronic
1027062083 7:75093562-75093584 CTGGGGATAGGGACGGGGTGGGG - Intronic
1027187402 7:75980577-75980599 CTGAGGACAGGGTGGGGGTCTGG - Intronic
1027189005 7:75987245-75987267 CCGAGGAAAAGGAGGAGGAAGGG + Exonic
1028397196 7:90383766-90383788 ATGAGGAAAAGTAGGGTGTATGG + Intronic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1030815053 7:114025236-114025258 CTGGGGATGAAGAGGGGCTAGGG - Intronic
1033584198 7:142762184-142762206 CTGAGCAGTAGGTGGGGGTAAGG + Intronic
1034418047 7:150975409-150975431 CTCAGGATAAGGAGTGGCTCAGG - Intronic
1034645423 7:152642056-152642078 CAGAGGCTAAGGAAGGGGTGGGG - Intergenic
1035518837 8:259838-259860 CGGAGGCTAAGGTGGGGGTGGGG - Intergenic
1036162932 8:6406307-6406329 CTGAGGATCAGGAAGGGGAGGGG - Intergenic
1036756500 8:11474807-11474829 GAGAGGAAAAGGAGGGGGTAAGG + Intergenic
1037918499 8:22787495-22787517 CTGACTACAAGGAGAGGGTATGG - Intronic
1038104458 8:24416751-24416773 CTGAGGTTAAGGAGAAGGGAGGG - Intergenic
1040629950 8:49198835-49198857 CTGAACATAAGGAGGGGCTCCGG + Intergenic
1040663509 8:49603077-49603099 CAGAGGCTAGGAAGGGGGTAGGG + Intergenic
1041945193 8:63433061-63433083 ATGAGGATAAGGAGGAGATAGGG + Intergenic
1042064048 8:64854184-64854206 TTGAGGATAAGGTGGTGGAAGGG + Intergenic
1042654213 8:71077777-71077799 GTGAGGAGAAGGAGGGTCTAGGG + Intergenic
1044339780 8:91033623-91033645 CTGAGGATAATGAGAAGCTATGG - Intronic
1044413344 8:91909607-91909629 GTGAGGCTCAGGTGGGGGTAGGG + Intergenic
1044926653 8:97214899-97214921 CTTAGAAAAAGGAGGGGGCAGGG - Intergenic
1045948869 8:107829264-107829286 CTGAGAATGAGGAGATGGTAGGG + Intergenic
1047505017 8:125472665-125472687 CTTAGGAAAAGGAGGAGGGAAGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049286764 8:141780148-141780170 CTGAGCAAAAGGAGGTGGTGGGG + Intergenic
1049644799 8:143731459-143731481 CTGAGGATGGGGAGGAGGTGTGG - Intronic
1049830894 8:144700239-144700261 CTCAGGAGAAGGAGCGGCTAAGG - Intergenic
1051513877 9:17907537-17907559 GGGAGGATTCGGAGGGGGTATGG - Intergenic
1051693290 9:19740721-19740743 GGGAGGATAGGGAGGAGGTATGG + Intronic
1052156010 9:25191609-25191631 CTGAGGATGATGAGGAGGAAGGG - Intergenic
1052194002 9:25690066-25690088 CTTACGGTAAGGATGGGGTAGGG - Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055205845 9:73729181-73729203 TTGAGGCTAAGGAGGAGGAATGG - Intergenic
1055899016 9:81213140-81213162 TTGATGGTCAGGAGGGGGTAGGG + Intergenic
1056280933 9:85040752-85040774 CTGAGGCTGAGGAGGGGGTGGGG - Intergenic
1056660036 9:88536399-88536421 CTGTTGCAAAGGAGGGGGTAGGG + Intronic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057218082 9:93240498-93240520 CTGTGGATGAGGAGTGGGTTGGG + Intronic
1057778793 9:98033415-98033437 CAGAGGTTAGGGAGGGGGTGGGG + Intergenic
1057816708 9:98301220-98301242 CTGAGGGTAGGGTGGGGGTCAGG + Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058618922 9:106863290-106863312 AAGAGGATAAGGAGGCGGTGGGG + Exonic
1059139899 9:111843104-111843126 CTGTGTATGAGGTGGGGGTAGGG + Intergenic
1059343243 9:113611565-113611587 CTTGGGATAAGGTGGGGGTTGGG + Intergenic
1060126592 9:121053622-121053644 TTGAAGATAGGGTGGGGGTAGGG + Intergenic
1060151408 9:121290995-121291017 ATGAGGATATGGAGGGTGCAAGG - Intronic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062691145 9:137842399-137842421 TGGAGGATACGGAGGGGGGACGG - Intronic
1203529384 Un_GL000213v1:124523-124545 CTGAGGCTGAGGAGGGGGATTGG - Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187811059 X:23177378-23177400 CTGAGGATTAGGATTGGGGATGG + Intergenic
1188330644 X:28866971-28866993 CTGAGAATAAGAAGGAGGGATGG + Intronic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1192205195 X:69091230-69091252 CTGAGGTGTAGGAGTGGGTATGG - Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1196902691 X:120401438-120401460 CTGATTATCAGGAGGAGGTAGGG + Intergenic
1197982374 X:132230329-132230351 CAGAGGGGAAGGTGGGGGTAGGG - Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198759663 X:140018163-140018185 CGGGGGATAAGGAGTGGGTGAGG + Intergenic
1198779123 X:140215887-140215909 CGGGGGATAAGGAGTGGGTGAGG - Intergenic
1199616830 X:149662692-149662714 CTGATCATCAGGAGGAGGTAGGG - Intergenic
1199625811 X:149740556-149740578 CTGATCATCAGGAGGAGGTAGGG + Intergenic
1199893384 X:152110041-152110063 CTGAGGGAAAGAAGGGGGAAGGG - Intergenic
1201300226 Y:12498705-12498727 AAGAGGAGAAGGAGGGGGAAGGG - Intergenic
1202338330 Y:23833115-23833137 TTGAGGAAAAGGGGTGGGTAAGG - Intergenic
1202532436 Y:25836956-25836978 TTGAGGAAAAGGGGTGGGTAAGG + Intergenic