ID: 1076827562

View in Genome Browser
Species Human (GRCh38)
Location 10:132976976-132976998
Sequence GGTCATCCCCAAGACTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827562_1076827569 1 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827569 10:132977000-132977022 CCCCGTCTCAGGCCAGCAGGTGG No data
1076827562_1076827577 30 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827577 10:132977029-132977051 CTCACTGCCCCTGAAGTCTTGGG No data
1076827562_1076827567 -2 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827567 10:132976997-132977019 CCTCCCCGTCTCAGGCCAGCAGG No data
1076827562_1076827571 2 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827571 10:132977001-132977023 CCCGTCTCAGGCCAGCAGGTGGG No data
1076827562_1076827565 -10 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827565 10:132976989-132977011 GGGGATGACCTCCCCGTCTCAGG No data
1076827562_1076827576 29 Left 1076827562 10:132976976-132976998 CCCCTGCAGTCTTGGGGATGACC No data
Right 1076827576 10:132977028-132977050 CCTCACTGCCCCTGAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827562 Original CRISPR GGTCATCCCCAAGACTGCAG GGG (reversed) Intergenic
No off target data available for this crispr