ID: 1076827579

View in Genome Browser
Species Human (GRCh38)
Location 10:132977036-132977058
Sequence GGTCATCCCCAAGACTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827579_1076827584 -2 Left 1076827579 10:132977036-132977058 CCCCTGAAGTCTTGGGGATGACC No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827579 Original CRISPR GGTCATCCCCAAGACTTCAG GGG (reversed) Intergenic
No off target data available for this crispr