ID: 1076827584

View in Genome Browser
Species Human (GRCh38)
Location 10:132977057-132977079
Sequence CCTCGCGTCCCAGGCAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827574_1076827584 7 Left 1076827574 10:132977027-132977049 CCCTCACTGCCCCTGAAGTCTTG No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data
1076827575_1076827584 6 Left 1076827575 10:132977028-132977050 CCTCACTGCCCCTGAAGTCTTGG No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data
1076827581_1076827584 -4 Left 1076827581 10:132977038-132977060 CCTGAAGTCTTGGGGATGACCTC No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data
1076827579_1076827584 -2 Left 1076827579 10:132977036-132977058 CCCCTGAAGTCTTGGGGATGACC No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data
1076827580_1076827584 -3 Left 1076827580 10:132977037-132977059 CCCTGAAGTCTTGGGGATGACCT No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data
1076827573_1076827584 22 Left 1076827573 10:132977012-132977034 CCAGCAGGTGGGTAACCCTCACT No data
Right 1076827584 10:132977057-132977079 CCTCGCGTCCCAGGCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827584 Original CRISPR CCTCGCGTCCCAGGCAGTCT TGG Intergenic
No off target data available for this crispr