ID: 1076827655

View in Genome Browser
Species Human (GRCh38)
Location 10:132977444-132977466
Sequence CCAAGACTAAGCCCAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827655_1076827666 27 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827666 10:132977494-132977516 GCAATCGGAGTGGAGCCCATGGG No data
1076827655_1076827660 -3 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data
1076827655_1076827661 3 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827661 10:132977470-132977492 TCTGGAAGAAACCGCGGAACTGG No data
1076827655_1076827665 26 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827665 10:132977493-132977515 TGCAATCGGAGTGGAGCCCATGG No data
1076827655_1076827662 12 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827662 10:132977479-132977501 AACCGCGGAACTGGTGCAATCGG No data
1076827655_1076827667 28 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827655_1076827664 17 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827664 10:132977484-132977506 CGGAACTGGTGCAATCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827655 Original CRISPR CCAAGACTAAGCCCAGGGTC AGG (reversed) Intergenic
No off target data available for this crispr