ID: 1076827657

View in Genome Browser
Species Human (GRCh38)
Location 10:132977449-132977471
Sequence GAAGTCCAAGACTAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827657_1076827664 12 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827664 10:132977484-132977506 CGGAACTGGTGCAATCGGAGTGG No data
1076827657_1076827662 7 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827662 10:132977479-132977501 AACCGCGGAACTGGTGCAATCGG No data
1076827657_1076827668 27 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827668 10:132977499-132977521 CGGAGTGGAGCCCATGGGGTAGG No data
1076827657_1076827667 23 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827657_1076827661 -2 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827661 10:132977470-132977492 TCTGGAAGAAACCGCGGAACTGG No data
1076827657_1076827665 21 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827665 10:132977493-132977515 TGCAATCGGAGTGGAGCCCATGG No data
1076827657_1076827666 22 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827666 10:132977494-132977516 GCAATCGGAGTGGAGCCCATGGG No data
1076827657_1076827660 -8 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827657 Original CRISPR GAAGTCCAAGACTAAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr