ID: 1076827658

View in Genome Browser
Species Human (GRCh38)
Location 10:132977450-132977472
Sequence AGAAGTCCAAGACTAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827658_1076827668 26 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827668 10:132977499-132977521 CGGAGTGGAGCCCATGGGGTAGG No data
1076827658_1076827664 11 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827664 10:132977484-132977506 CGGAACTGGTGCAATCGGAGTGG No data
1076827658_1076827662 6 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827662 10:132977479-132977501 AACCGCGGAACTGGTGCAATCGG No data
1076827658_1076827661 -3 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827661 10:132977470-132977492 TCTGGAAGAAACCGCGGAACTGG No data
1076827658_1076827667 22 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827658_1076827660 -9 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data
1076827658_1076827666 21 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827666 10:132977494-132977516 GCAATCGGAGTGGAGCCCATGGG No data
1076827658_1076827665 20 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827665 10:132977493-132977515 TGCAATCGGAGTGGAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827658 Original CRISPR AGAAGTCCAAGACTAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr