ID: 1076827660

View in Genome Browser
Species Human (GRCh38)
Location 10:132977464-132977486
Sequence TGGACTTCTGGAAGAAACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827658_1076827660 -9 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data
1076827655_1076827660 -3 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data
1076827652_1076827660 9 Left 1076827652 10:132977432-132977454 CCGAACACAGCACCTGACCCTGG No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data
1076827657_1076827660 -8 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827660 10:132977464-132977486 TGGACTTCTGGAAGAAACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827660 Original CRISPR TGGACTTCTGGAAGAAACCG CGG Intergenic
No off target data available for this crispr