ID: 1076827663

View in Genome Browser
Species Human (GRCh38)
Location 10:132977481-132977503
Sequence CTCCGATTGCACCAGTTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827663_1076827671 18 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827671 10:132977522-132977544 TGTTGCCATTGAGCCAACGCTGG No data
1076827663_1076827667 -9 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827663_1076827668 -5 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827668 10:132977499-132977521 CGGAGTGGAGCCCATGGGGTAGG No data
1076827663_1076827666 -10 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827666 10:132977494-132977516 GCAATCGGAGTGGAGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827663 Original CRISPR CTCCGATTGCACCAGTTCCG CGG (reversed) Intergenic
No off target data available for this crispr