ID: 1076827667

View in Genome Browser
Species Human (GRCh38)
Location 10:132977495-132977517
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827655_1076827667 28 Left 1076827655 10:132977444-132977466 CCTGACCCTGGGCTTAGTCTTGG No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827663_1076827667 -9 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827657_1076827667 23 Left 1076827657 10:132977449-132977471 CCCTGGGCTTAGTCTTGGACTTC No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data
1076827658_1076827667 22 Left 1076827658 10:132977450-132977472 CCTGGGCTTAGTCTTGGACTTCT No data
Right 1076827667 10:132977495-132977517 CAATCGGAGTGGAGCCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827667 Original CRISPR CAATCGGAGTGGAGCCCATG GGG Intergenic
No off target data available for this crispr