ID: 1076827671

View in Genome Browser
Species Human (GRCh38)
Location 10:132977522-132977544
Sequence TGTTGCCATTGAGCCAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827663_1076827671 18 Left 1076827663 10:132977481-132977503 CCGCGGAACTGGTGCAATCGGAG No data
Right 1076827671 10:132977522-132977544 TGTTGCCATTGAGCCAACGCTGG No data
1076827669_1076827671 -10 Left 1076827669 10:132977509-132977531 CCCATGGGGTAGGTGTTGCCATT No data
Right 1076827671 10:132977522-132977544 TGTTGCCATTGAGCCAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827671 Original CRISPR TGTTGCCATTGAGCCAACGC TGG Intergenic
No off target data available for this crispr