ID: 1076827742

View in Genome Browser
Species Human (GRCh38)
Location 10:132978061-132978083
Sequence TCCGTGTCCCGCGTCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076827742_1076827754 28 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827754 10:132978112-132978134 GATGTCCCCACAGAGACGCGGGG No data
1076827742_1076827752 26 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827752 10:132978110-132978132 GAGATGTCCCCACAGAGACGCGG No data
1076827742_1076827746 -1 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827746 10:132978083-132978105 AGACGTCCCCCAGAGACGCGGGG No data
1076827742_1076827745 -2 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827745 10:132978082-132978104 GAGACGTCCCCCAGAGACGCGGG No data
1076827742_1076827747 4 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827747 10:132978088-132978110 TCCCCCAGAGACGCGGGGCACGG No data
1076827742_1076827753 27 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827753 10:132978111-132978133 AGATGTCCCCACAGAGACGCGGG No data
1076827742_1076827744 -3 Left 1076827742 10:132978061-132978083 CCCACAGAGACGCGGGACACGGA No data
Right 1076827744 10:132978081-132978103 GGAGACGTCCCCCAGAGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076827742 Original CRISPR TCCGTGTCCCGCGTCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr