ID: 1076828835

View in Genome Browser
Species Human (GRCh38)
Location 10:132983984-132984006
Sequence TCTGGGGGGCTCCCCGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076828824_1076828835 28 Left 1076828824 10:132983933-132983955 CCAGTGCATGGATGAGCACGTCC No data
Right 1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG No data
1076828825_1076828835 7 Left 1076828825 10:132983954-132983976 CCTGTTCACGCGTCCTCGCCATT No data
Right 1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG No data
1076828829_1076828835 -6 Left 1076828829 10:132983967-132983989 CCTCGCCATTGGTGGTGTCTGGG No data
Right 1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076828835 Original CRISPR TCTGGGGGGCTCCCCGCTGC TGG Intergenic
No off target data available for this crispr