ID: 1076830758

View in Genome Browser
Species Human (GRCh38)
Location 10:132993017-132993039
Sequence GAGTCCGCCGGGGGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830758_1076830772 6 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830758_1076830775 21 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830775 10:132993061-132993083 TCTCAGGGCGAGGCCATCCGTGG No data
1076830758_1076830776 28 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830758_1076830771 5 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830771 10:132993045-132993067 ATACCTGGGCGGAGACTCTCAGG No data
1076830758_1076830768 -9 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830768 10:132993031-132993053 GGCGGACTCCAGGCATACCTGGG No data
1076830758_1076830769 -6 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830769 10:132993034-132993056 GGACTCCAGGCATACCTGGGCGG No data
1076830758_1076830767 -10 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830767 10:132993030-132993052 CGGCGGACTCCAGGCATACCTGG No data
1076830758_1076830774 11 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830774 10:132993051-132993073 GGGCGGAGACTCTCAGGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830758 Original CRISPR GAGTCCGCCGGGGGCGGGGC TGG (reversed) Intergenic
No off target data available for this crispr