ID: 1076830763

View in Genome Browser
Species Human (GRCh38)
Location 10:132993026-132993048
Sequence GTATGCCTGGAGTCCGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830763_1076830772 -3 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830763_1076830774 2 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830774 10:132993051-132993073 GGGCGGAGACTCTCAGGGCGAGG No data
1076830763_1076830775 12 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830775 10:132993061-132993083 TCTCAGGGCGAGGCCATCCGTGG No data
1076830763_1076830776 19 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830763_1076830778 25 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830778 10:132993074-132993096 CCATCCGTGGCTGATGGATCTGG No data
1076830763_1076830779 26 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830763_1076830771 -4 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830771 10:132993045-132993067 ATACCTGGGCGGAGACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830763 Original CRISPR GTATGCCTGGAGTCCGCCGG GGG (reversed) Intergenic
No off target data available for this crispr