ID: 1076830770

View in Genome Browser
Species Human (GRCh38)
Location 10:132993039-132993061
Sequence AGTCTCCGCCCAGGTATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830770_1076830776 6 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830770_1076830775 -1 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830775 10:132993061-132993083 TCTCAGGGCGAGGCCATCCGTGG No data
1076830770_1076830779 13 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830770_1076830781 20 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830781 10:132993082-132993104 GGCTGATGGATCTGGGCGAGTGG No data
1076830770_1076830778 12 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830778 10:132993074-132993096 CCATCCGTGGCTGATGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830770 Original CRISPR AGTCTCCGCCCAGGTATGCC TGG (reversed) Intergenic
No off target data available for this crispr