ID: 1076830772

View in Genome Browser
Species Human (GRCh38)
Location 10:132993046-132993068
Sequence TACCTGGGCGGAGACTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830766_1076830772 -6 Left 1076830766 10:132993029-132993051 CCGGCGGACTCCAGGCATACCTG No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830752_1076830772 18 Left 1076830752 10:132993005-132993027 CCCGTCCCAGCACCAGCCCCGCC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830754_1076830772 13 Left 1076830754 10:132993010-132993032 CCCAGCACCAGCCCCGCCCCCGG No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830762_1076830772 0 Left 1076830762 10:132993023-132993045 CCGCCCCCGGCGGACTCCAGGCA No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830763_1076830772 -3 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830750_1076830772 25 Left 1076830750 10:132992998-132993020 CCCTGAGCCCGTCCCAGCACCAG No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830753_1076830772 17 Left 1076830753 10:132993006-132993028 CCGTCCCAGCACCAGCCCCGCCC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830756_1076830772 12 Left 1076830756 10:132993011-132993033 CCAGCACCAGCCCCGCCCCCGGC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830751_1076830772 24 Left 1076830751 10:132992999-132993021 CCTGAGCCCGTCCCAGCACCAGC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830758_1076830772 6 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830759_1076830772 2 Left 1076830759 10:132993021-132993043 CCCCGCCCCCGGCGGACTCCAGG No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830764_1076830772 -4 Left 1076830764 10:132993027-132993049 CCCCGGCGGACTCCAGGCATACC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830765_1076830772 -5 Left 1076830765 10:132993028-132993050 CCCGGCGGACTCCAGGCATACCT No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data
1076830761_1076830772 1 Left 1076830761 10:132993022-132993044 CCCGCCCCCGGCGGACTCCAGGC No data
Right 1076830772 10:132993046-132993068 TACCTGGGCGGAGACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830772 Original CRISPR TACCTGGGCGGAGACTCTCA GGG Intergenic
No off target data available for this crispr