ID: 1076830776

View in Genome Browser
Species Human (GRCh38)
Location 10:132993068-132993090
Sequence GCGAGGCCATCCGTGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830759_1076830776 24 Left 1076830759 10:132993021-132993043 CCCCGCCCCCGGCGGACTCCAGG No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830766_1076830776 16 Left 1076830766 10:132993029-132993051 CCGGCGGACTCCAGGCATACCTG No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830758_1076830776 28 Left 1076830758 10:132993017-132993039 CCAGCCCCGCCCCCGGCGGACTC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830770_1076830776 6 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830765_1076830776 17 Left 1076830765 10:132993028-132993050 CCCGGCGGACTCCAGGCATACCT No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830773_1076830776 -3 Left 1076830773 10:132993048-132993070 CCTGGGCGGAGACTCTCAGGGCG No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830763_1076830776 19 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830761_1076830776 23 Left 1076830761 10:132993022-132993044 CCCGCCCCCGGCGGACTCCAGGC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830762_1076830776 22 Left 1076830762 10:132993023-132993045 CCGCCCCCGGCGGACTCCAGGCA No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data
1076830764_1076830776 18 Left 1076830764 10:132993027-132993049 CCCCGGCGGACTCCAGGCATACC No data
Right 1076830776 10:132993068-132993090 GCGAGGCCATCCGTGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830776 Original CRISPR GCGAGGCCATCCGTGGCTGA TGG Intergenic
No off target data available for this crispr