ID: 1076830779

View in Genome Browser
Species Human (GRCh38)
Location 10:132993075-132993097
Sequence CATCCGTGGCTGATGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076830763_1076830779 26 Left 1076830763 10:132993026-132993048 CCCCCGGCGGACTCCAGGCATAC No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830761_1076830779 30 Left 1076830761 10:132993022-132993044 CCCGCCCCCGGCGGACTCCAGGC No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830770_1076830779 13 Left 1076830770 10:132993039-132993061 CCAGGCATACCTGGGCGGAGACT No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830764_1076830779 25 Left 1076830764 10:132993027-132993049 CCCCGGCGGACTCCAGGCATACC No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830766_1076830779 23 Left 1076830766 10:132993029-132993051 CCGGCGGACTCCAGGCATACCTG No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830765_1076830779 24 Left 1076830765 10:132993028-132993050 CCCGGCGGACTCCAGGCATACCT No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830773_1076830779 4 Left 1076830773 10:132993048-132993070 CCTGGGCGGAGACTCTCAGGGCG No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data
1076830762_1076830779 29 Left 1076830762 10:132993023-132993045 CCGCCCCCGGCGGACTCCAGGCA No data
Right 1076830779 10:132993075-132993097 CATCCGTGGCTGATGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076830779 Original CRISPR CATCCGTGGCTGATGGATCT GGG Intergenic
No off target data available for this crispr