ID: 1076831479

View in Genome Browser
Species Human (GRCh38)
Location 10:132996532-132996554
Sequence GGGTGGGTCTTCGTGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076831479_1076831496 23 Left 1076831479 10:132996532-132996554 CCTGACCCCACGAAGACCCACCC No data
Right 1076831496 10:132996578-132996600 GGAGACCCTTCCTGACCCCACGG No data
1076831479_1076831488 2 Left 1076831479 10:132996532-132996554 CCTGACCCCACGAAGACCCACCC No data
Right 1076831488 10:132996557-132996579 GGAGACCCACCCTGACCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076831479 Original CRISPR GGGTGGGTCTTCGTGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr