ID: 1076831868

View in Genome Browser
Species Human (GRCh38)
Location 10:132999426-132999448
Sequence ATGGAGGTGGAGAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076831868_1076831874 -2 Left 1076831868 10:132999426-132999448 CCCTCCTGTTTCTCCACCTCCAT No data
Right 1076831874 10:132999447-132999469 ATCCCCTGAGCCTCCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076831868 Original CRISPR ATGGAGGTGGAGAAACAGGA GGG (reversed) Intergenic
No off target data available for this crispr