ID: 1076831920

View in Genome Browser
Species Human (GRCh38)
Location 10:132999602-132999624
Sequence ATGGAGGTGGAGAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076831920_1076831927 -2 Left 1076831920 10:132999602-132999624 CCCTCCTGTTTCTCCACCTCCAT No data
Right 1076831927 10:132999623-132999645 ATCCCCTGAGCCTCCCGGCGAGG No data
1076831920_1076831925 -7 Left 1076831920 10:132999602-132999624 CCCTCCTGTTTCTCCACCTCCAT No data
Right 1076831925 10:132999618-132999640 CCTCCATCCCCTGAGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076831920 Original CRISPR ATGGAGGTGGAGAAACAGGA GGG (reversed) Intergenic
No off target data available for this crispr