ID: 1076832689

View in Genome Browser
Species Human (GRCh38)
Location 10:133004595-133004617
Sequence CACACGGACGCGCATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076832687_1076832689 -5 Left 1076832687 10:133004577-133004599 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1076832689 10:133004595-133004617 CACACGGACGCGCATGAAAGAGG No data
1076832684_1076832689 14 Left 1076832684 10:133004558-133004580 CCATGTTGCTCACACAAAGCCTG 0: 1153
1: 517
2: 138
3: 64
4: 213
Right 1076832689 10:133004595-133004617 CACACGGACGCGCATGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076832689 Original CRISPR CACACGGACGCGCATGAAAG AGG Intergenic
No off target data available for this crispr