ID: 1076833213

View in Genome Browser
Species Human (GRCh38)
Location 10:133007292-133007314
Sequence AGGGCCAACTGAATGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076833207_1076833213 -4 Left 1076833207 10:133007273-133007295 CCTCAGTTTACCTTCACCCAGGG No data
Right 1076833213 10:133007292-133007314 AGGGCCAACTGAATGGCTCCTGG No data
1076833205_1076833213 8 Left 1076833205 10:133007261-133007283 CCAGCACACGGGCCTCAGTTTAC No data
Right 1076833213 10:133007292-133007314 AGGGCCAACTGAATGGCTCCTGG No data
1076833204_1076833213 9 Left 1076833204 10:133007260-133007282 CCCAGCACACGGGCCTCAGTTTA No data
Right 1076833213 10:133007292-133007314 AGGGCCAACTGAATGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076833213 Original CRISPR AGGGCCAACTGAATGGCTCC TGG Intergenic
No off target data available for this crispr