ID: 1076834267

View in Genome Browser
Species Human (GRCh38)
Location 10:133013152-133013174
Sequence GGTGCCCAGCAACCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076834267_1076834274 21 Left 1076834267 10:133013152-133013174 CCTGCCTGGGGTTGCTGGGCACC No data
Right 1076834274 10:133013196-133013218 CCCACAGTGAAGATGGGTCAGGG No data
1076834267_1076834271 15 Left 1076834267 10:133013152-133013174 CCTGCCTGGGGTTGCTGGGCACC No data
Right 1076834271 10:133013190-133013212 AAAAAACCCACAGTGAAGATGGG No data
1076834267_1076834270 14 Left 1076834267 10:133013152-133013174 CCTGCCTGGGGTTGCTGGGCACC No data
Right 1076834270 10:133013189-133013211 TAAAAAACCCACAGTGAAGATGG No data
1076834267_1076834276 22 Left 1076834267 10:133013152-133013174 CCTGCCTGGGGTTGCTGGGCACC No data
Right 1076834276 10:133013197-133013219 CCACAGTGAAGATGGGTCAGGGG No data
1076834267_1076834272 20 Left 1076834267 10:133013152-133013174 CCTGCCTGGGGTTGCTGGGCACC No data
Right 1076834272 10:133013195-133013217 ACCCACAGTGAAGATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076834267 Original CRISPR GGTGCCCAGCAACCCCAGGC AGG (reversed) Intergenic
No off target data available for this crispr