ID: 1076835763

View in Genome Browser
Species Human (GRCh38)
Location 10:133020332-133020354
Sequence CGGGTCCTTGGGTGTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076835763_1076835776 5 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835776 10:133020360-133020382 CTGGGGTGGGCGCCGGCTGTGGG No data
1076835763_1076835771 -8 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835771 10:133020347-133020369 AGGACCCGAGTCGCTGGGGTGGG No data
1076835763_1076835777 6 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835777 10:133020361-133020383 TGGGGTGGGCGCCGGCTGTGGGG No data
1076835763_1076835774 -2 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835774 10:133020353-133020375 CGAGTCGCTGGGGTGGGCGCCGG No data
1076835763_1076835779 17 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835779 10:133020372-133020394 CCGGCTGTGGGGCAGAGACGCGG No data
1076835763_1076835775 4 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835775 10:133020359-133020381 GCTGGGGTGGGCGCCGGCTGTGG No data
1076835763_1076835770 -9 Left 1076835763 10:133020332-133020354 CCAGTCCAACACCCAAGGACCCG No data
Right 1076835770 10:133020346-133020368 AAGGACCCGAGTCGCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076835763 Original CRISPR CGGGTCCTTGGGTGTTGGAC TGG (reversed) Intergenic
No off target data available for this crispr