ID: 1076836001

View in Genome Browser
Species Human (GRCh38)
Location 10:133021220-133021242
Sequence GCCCTGGGTTGAGGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076835987_1076836001 -2 Left 1076835987 10:133021199-133021221 CCCTCCGCGGTCCCGGCCCCAGC No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835988_1076836001 -3 Left 1076835988 10:133021200-133021222 CCTCCGCGGTCCCGGCCCCAGCC No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835983_1076836001 7 Left 1076835983 10:133021190-133021212 CCCGTCAGCCCCTCCGCGGTCCC No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835980_1076836001 12 Left 1076835980 10:133021185-133021207 CCCTTCCCGTCAGCCCCTCCGCG No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835979_1076836001 15 Left 1076835979 10:133021182-133021204 CCGCCCTTCCCGTCAGCCCCTCC No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835984_1076836001 6 Left 1076835984 10:133021191-133021213 CCGTCAGCCCCTCCGCGGTCCCG No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835986_1076836001 -1 Left 1076835986 10:133021198-133021220 CCCCTCCGCGGTCCCGGCCCCAG No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835981_1076836001 11 Left 1076835981 10:133021186-133021208 CCTTCCCGTCAGCCCCTCCGCGG No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data
1076835989_1076836001 -6 Left 1076835989 10:133021203-133021225 CCGCGGTCCCGGCCCCAGCCCTG No data
Right 1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076836001 Original CRISPR GCCCTGGGTTGAGGGAGGGC TGG Intergenic
No off target data available for this crispr