ID: 1076839615

View in Genome Browser
Species Human (GRCh38)
Location 10:133039575-133039597
Sequence CGTCCACACGGGCTGGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076839615_1076839622 -2 Left 1076839615 10:133039575-133039597 CCCCTCGCCAGCCCGTGTGGACG No data
Right 1076839622 10:133039596-133039618 CGCTGGAACACCGTGTGCAGAGG No data
1076839615_1076839626 14 Left 1076839615 10:133039575-133039597 CCCCTCGCCAGCCCGTGTGGACG No data
Right 1076839626 10:133039612-133039634 GCAGAGGCTGCTGAGCAGAGGGG No data
1076839615_1076839624 12 Left 1076839615 10:133039575-133039597 CCCCTCGCCAGCCCGTGTGGACG No data
Right 1076839624 10:133039610-133039632 GTGCAGAGGCTGCTGAGCAGAGG No data
1076839615_1076839625 13 Left 1076839615 10:133039575-133039597 CCCCTCGCCAGCCCGTGTGGACG No data
Right 1076839625 10:133039611-133039633 TGCAGAGGCTGCTGAGCAGAGGG No data
1076839615_1076839627 22 Left 1076839615 10:133039575-133039597 CCCCTCGCCAGCCCGTGTGGACG No data
Right 1076839627 10:133039620-133039642 TGCTGAGCAGAGGGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076839615 Original CRISPR CGTCCACACGGGCTGGCGAG GGG (reversed) Intergenic
No off target data available for this crispr