ID: 1076841252

View in Genome Browser
Species Human (GRCh38)
Location 10:133046902-133046924
Sequence GGGCACTGAACAATAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076841252_1076841256 -4 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841256 10:133046921-133046943 GCCCAGGCTAACGGAATGCAGGG No data
1076841252_1076841260 -2 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841260 10:133046923-133046945 CCAGGCTAACGGAATGCAGGGGG No data
1076841252_1076841264 21 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841264 10:133046946-133046968 TACTGCACGAGGCTGATTTGGGG No data
1076841252_1076841263 20 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841263 10:133046945-133046967 GTACTGCACGAGGCTGATTTGGG No data
1076841252_1076841262 19 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841262 10:133046944-133046966 GGTACTGCACGAGGCTGATTTGG No data
1076841252_1076841258 -3 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841258 10:133046922-133046944 CCCAGGCTAACGGAATGCAGGGG No data
1076841252_1076841265 25 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841265 10:133046950-133046972 GCACGAGGCTGATTTGGGGCTGG No data
1076841252_1076841261 10 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841261 10:133046935-133046957 AATGCAGGGGGTACTGCACGAGG No data
1076841252_1076841255 -5 Left 1076841252 10:133046902-133046924 CCATGCATTATTGTTCAGTGCCC No data
Right 1076841255 10:133046920-133046942 TGCCCAGGCTAACGGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076841252 Original CRISPR GGGCACTGAACAATAATGCA TGG (reversed) Intergenic
No off target data available for this crispr