ID: 1076841436

View in Genome Browser
Species Human (GRCh38)
Location 10:133047776-133047798
Sequence TTGGCCGGTGACACTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076841436_1076841444 -6 Left 1076841436 10:133047776-133047798 CCCCCTCCAGTGTCACCGGCCAA No data
Right 1076841444 10:133047793-133047815 GGCCAACGGTGCCGGCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076841436 Original CRISPR TTGGCCGGTGACACTGGAGG GGG (reversed) Intergenic
No off target data available for this crispr