ID: 1076841513

View in Genome Browser
Species Human (GRCh38)
Location 10:133048218-133048240
Sequence GAGGCCACTCACGTGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076841506_1076841513 27 Left 1076841506 10:133048168-133048190 CCCAGCCACTGGCTCTGTTCAGT No data
Right 1076841513 10:133048218-133048240 GAGGCCACTCACGTGTGGACAGG No data
1076841507_1076841513 26 Left 1076841507 10:133048169-133048191 CCAGCCACTGGCTCTGTTCAGTT No data
Right 1076841513 10:133048218-133048240 GAGGCCACTCACGTGTGGACAGG No data
1076841508_1076841513 22 Left 1076841508 10:133048173-133048195 CCACTGGCTCTGTTCAGTTGTTT No data
Right 1076841513 10:133048218-133048240 GAGGCCACTCACGTGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076841513 Original CRISPR GAGGCCACTCACGTGTGGAC AGG Intergenic
No off target data available for this crispr