ID: 1076844884

View in Genome Browser
Species Human (GRCh38)
Location 10:133065251-133065273
Sequence AGGAGTGGCCAGCCCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076844884_1076844895 28 Left 1076844884 10:133065251-133065273 CCCTCCTCGGGCTGGCCACTCCT No data
Right 1076844895 10:133065302-133065324 TGTATGTTTCCCCTGTCCACAGG No data
1076844884_1076844896 29 Left 1076844884 10:133065251-133065273 CCCTCCTCGGGCTGGCCACTCCT No data
Right 1076844896 10:133065303-133065325 GTATGTTTCCCCTGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076844884 Original CRISPR AGGAGTGGCCAGCCCGAGGA GGG (reversed) Intergenic
No off target data available for this crispr